ID: 954574052

View in Genome Browser
Species Human (GRCh38)
Location 3:51665158-51665180
Sequence TGGGGGATACAGAGGGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954574052_954574067 22 Left 954574052 3:51665158-51665180 CCCCGCCCCCTCTGTATCCCCCA 0: 1
1: 0
2: 4
3: 39
4: 389
Right 954574067 3:51665203-51665225 TCTTTATGATGAACAAACTTTGG 0: 1
1: 0
2: 0
3: 20
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954574052 Original CRISPR TGGGGGATACAGAGGGGGCG GGG (reversed) Exonic
900095019 1:936697-936719 TGGGGGACACAGATGGGGGTGGG - Intronic
900191971 1:1355807-1355829 TGGGGGAGTCAGTGGGGGAGGGG + Intronic
900396533 1:2455364-2455386 CGAGGGATGCAGAGGGGGCCTGG - Intronic
900805347 1:4763862-4763884 TGGGGGAGAAAGAGGGAGGGAGG - Intronic
900900412 1:5512131-5512153 TGGGGGTTACAGAGAAGGTGTGG - Intergenic
900901114 1:5516695-5516717 TGTGGCTTACAGAGGGGGCCTGG - Intergenic
901300268 1:8195257-8195279 TGGGGGATCCAGAGGGACCCAGG + Intergenic
903738468 1:25544589-25544611 TGGGGGAGAGAAAGGGGGGGAGG - Intronic
903757289 1:25671427-25671449 TTGGGGATACAGAGGGGAATAGG + Intronic
904284751 1:29446742-29446764 TGAGGGATGCAGATGGGACGCGG + Intergenic
904448654 1:30597041-30597063 TGGGCTCTACAGAGGGGGCGAGG - Intergenic
906264548 1:44418194-44418216 AGGGGGACACAGCGCGGGCGTGG + Intronic
906718426 1:47987804-47987826 TGGGGGAGACACAGCGGGTGTGG + Intronic
907516332 1:54995605-54995627 TGGGTGAGTGAGAGGGGGCGTGG + Intergenic
907664053 1:56418589-56418611 TGGGGGTGGCAGTGGGGGCGCGG - Intergenic
908001538 1:59685095-59685117 TGGGGGATACGCAGAGGGCAGGG - Intronic
908820306 1:68078830-68078852 TGGGGGATGCAGTGGGGGAAGGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
912214577 1:107593468-107593490 TGGAGGATACAGAGCAGGCAAGG - Intronic
915159762 1:153909688-153909710 TTTGGGAGACTGAGGGGGCGGGG + Intronic
915552768 1:156644767-156644789 TGGGGGATAAACAGTGGGCCTGG + Intronic
915554595 1:156654372-156654394 TGGGGGATAGGGAGGGGGTTTGG + Intronic
915585571 1:156842095-156842117 TCGGGGGTACAGAGGGTGCCAGG - Exonic
916080443 1:161228856-161228878 TGGGGGATGCAGAGGAGGGAGGG + Intronic
916511451 1:165475354-165475376 TTGGGGATAGAGAGTGGGCCAGG - Intergenic
917305796 1:173623244-173623266 TGGGGGTTACAGTGGAGGCGGGG + Intronic
920917842 1:210272575-210272597 TGGGGGAAAATGTGGGGGCGGGG + Intergenic
921367212 1:214384621-214384643 TGGAGGATACAGGGGAGGCCTGG + Exonic
922818834 1:228470457-228470479 TGGGGGATACCGGGGTGGGGCGG + Intergenic
924172327 1:241356213-241356235 TGGGGGATGCGGTGGGGGAGTGG + Intronic
924532012 1:244901492-244901514 TGGGGGAGTCTGAGGGGGAGGGG - Intergenic
1063087399 10:2832181-2832203 TGGGGGCTTCAGAGGGAGCATGG - Intergenic
1064679117 10:17791588-17791610 TGGGGGATGCAGAGAGGAAGTGG - Intronic
1065757882 10:28951013-28951035 TGGGGGAAACAGTGGGAGGGTGG - Intergenic
1067237448 10:44462961-44462983 TGGGGGATGCAGGGGGTGGGAGG - Intergenic
1067258594 10:44666599-44666621 AGGGGGAGAGAGAGGGGGAGAGG + Intergenic
1068807807 10:61219258-61219280 TAGGGGAAACTGTGGGGGCGGGG - Intergenic
1069253704 10:66305067-66305089 TGGGGGTTAGAGAGGGGCTGAGG - Intronic
1069662449 10:70132544-70132566 TGGGGGAGACAGAGAGGGGCGGG + Intronic
1069723960 10:70565877-70565899 TGGGGGATTCAGCTGGGGAGGGG - Intronic
1069740394 10:70683490-70683512 TGGAGGACACAGAGGGGCTGTGG + Intronic
1069766566 10:70865522-70865544 TGGGGGAGACAGAGTGGGAGAGG - Intronic
1070628154 10:78065971-78065993 TGTGTGATACAGAGAGGGTGAGG + Intergenic
1071213579 10:83372720-83372742 TGGAGGAAACAGAGGGGGTGAGG - Intergenic
1071971920 10:90916116-90916138 TGGGGGACAGGGAGGGGGAGGGG + Intronic
1072484555 10:95842726-95842748 TGGGGGATTCAAAGGGGAAGGGG + Intronic
1072942514 10:99779489-99779511 TGTGGTATACAGTGGGGGAGGGG + Intergenic
1075520916 10:123143089-123143111 TGGGGGACAGCGAGAGGGCGGGG - Intergenic
1076178113 10:128384336-128384358 TGGGGAATTCAGAGTGGGCCTGG + Intergenic
1077041532 11:526480-526502 TAGGGGAGACACTGGGGGCGGGG - Intergenic
1077179558 11:1206176-1206198 GGGTGGATACAGAGGTGGCCAGG + Intergenic
1077330264 11:1981049-1981071 TGGGGCAGGCAGAGGGGGTGTGG + Intronic
1077341665 11:2028954-2028976 TGGGGAAGACGGAGGGGGCTGGG + Intergenic
1077419663 11:2444537-2444559 GGGGAGATGCAGACGGGGCGGGG + Intergenic
1077498960 11:2900400-2900422 TGGGGGAAACAGGCTGGGCGCGG + Intronic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1083691159 11:64409732-64409754 TGGGGGATAGCGAGGGGGATTGG - Intergenic
1083734579 11:64672141-64672163 TGGGGAGTACAGTGGGGGCTGGG - Intronic
1083912635 11:65719238-65719260 TGGGAGCTGCAGTGGGGGCGGGG - Exonic
1083925515 11:65803788-65803810 TGGGGGATCCGGAGTGAGCGAGG + Intergenic
1084592527 11:70098829-70098851 TGGTGGATACACAGTGGGCAGGG - Intronic
1085555048 11:77411984-77412006 TTGGCGAAACAGAAGGGGCGGGG + Intronic
1085715214 11:78866598-78866620 TGGGGGAGACATGGGGGGAGGGG + Intronic
1085743576 11:79096499-79096521 TGGGGCTTACAGAGTGGGGGTGG - Intronic
1089009519 11:115121178-115121200 TGGTGCAGACAGAGGGGGAGTGG + Intergenic
1089183330 11:116597801-116597823 TGGGAAATACAGAGGGGACGGGG + Intergenic
1089203625 11:116740738-116740760 TGGGGGGTTGAGGGGGGGCGAGG - Intergenic
1089696478 11:120219101-120219123 TGGGGAATTCACAGGGGGGGTGG + Intronic
1089789478 11:120932380-120932402 TGGGGGATTCAGGGTGGGCGGGG - Intronic
1089795198 11:120974720-120974742 AGGGAGAGTCAGAGGGGGCGAGG - Intronic
1090408134 11:126489657-126489679 TGGGGAATGCAGAGGGGAAGGGG - Intronic
1090608791 11:128451817-128451839 TGGGAGCTCCAGAGTGGGCGAGG + Intergenic
1091186403 11:133651543-133651565 TGGAGGCTATAGAGGGGGCAGGG - Intergenic
1202813243 11_KI270721v1_random:36228-36250 TGGGGCAGGCAGAGGGGGTGTGG + Intergenic
1202824651 11_KI270721v1_random:84143-84165 TGGGGAAGACGGAGGGGGCTGGG + Intergenic
1091839996 12:3613971-3613993 TGGGGCACACAGAGAGGGAGAGG - Intronic
1091874815 12:3925057-3925079 TGGGGTGTAGAGAGGGGGTGGGG - Intergenic
1093216918 12:16373266-16373288 TGGGGGATAAAGAGGGGTTGAGG + Intronic
1093356621 12:18174901-18174923 TGGGGGAAAAAGAGGGAGAGGGG + Intronic
1094842125 12:34346551-34346573 TATGCGCTACAGAGGGGGCGTGG + Intergenic
1096073784 12:48789540-48789562 TTGGGGATGAAGAGTGGGCGCGG - Intergenic
1096154526 12:49334624-49334646 TGCGGGTTTCAGAGGGGGAGGGG - Intronic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097626635 12:62010162-62010184 TGGGGGAGAGGGAGGGGGAGGGG - Intronic
1097728787 12:63104564-63104586 TGGGGGTTAGAGAGGTGGAGAGG - Intergenic
1098467277 12:70801778-70801800 TGGGAGATAGAGAGGGAGGGAGG - Intronic
1098595842 12:72272601-72272623 GGGGGGTGCCAGAGGGGGCGGGG + Intronic
1100685902 12:96985737-96985759 TGGGGGACAAGGAGGGGGAGAGG + Intergenic
1101061299 12:100975306-100975328 TGGGCTAAAAAGAGGGGGCGAGG - Intronic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102394616 12:112575393-112575415 TGGGGGCTCCCGTGGGGGCGCGG + Intronic
1103058842 12:117842764-117842786 TGGGCAAGACAGAGGGGGCAGGG + Intronic
1103166297 12:118773314-118773336 TGGGGGCAAGATAGGGGGCGTGG + Intergenic
1103836736 12:123827511-123827533 TGGGTGGGACAGAGGGGGCATGG + Intronic
1104634084 12:130426912-130426934 TGGGGCACACAGAGGGGTCGTGG + Intronic
1105019640 12:132807765-132807787 TGGGGCCAACAGAGGGGGCGGGG - Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107785205 13:43948755-43948777 TGGGGGATGGAGAAGGGGAGAGG + Intergenic
1107804581 13:44142031-44142053 TGGGGGAGGCGGAGCGGGCGGGG - Intergenic
1107851618 13:44577289-44577311 TGGGGGATACGGTGGAGCCGGGG - Intergenic
1108065970 13:46577933-46577955 TGGGGGATGCAGAAGGGCAGTGG + Intronic
1111672748 13:91348932-91348954 TGGGGGACACAAAGGAGGGGCGG + Intergenic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1114430555 14:22656976-22656998 TGGGGGATAAAGAGGTGGAGGGG + Intergenic
1119003525 14:70904793-70904815 TGGGGGGGAATGAGGGGGCGGGG - Intergenic
1119683010 14:76606850-76606872 TGGGGGAGAGAGAGAGAGCGGGG + Intergenic
1120726649 14:87949604-87949626 GGCGGGATACAGAGGGTGAGTGG + Intronic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121011421 14:90522383-90522405 TGGGAGAAACAGAGGCGGGGAGG + Intergenic
1121310653 14:92933476-92933498 TGGGGAAGACAAATGGGGCGTGG + Intronic
1122076285 14:99237068-99237090 TGGGGGGTGTAGAGGGGGAGTGG + Intronic
1122918766 14:104871027-104871049 TGGGGGCAACAGAGGGGCCAAGG - Intronic
1122956436 14:105073651-105073673 TGGGGGCTGCAGTGGGGGCCTGG + Intergenic
1122956980 14:105075485-105075507 CGGGGGATAGGGATGGGGCGGGG + Intergenic
1124991037 15:34673995-34674017 TGGGAGATACAGAGCTGGAGAGG - Intergenic
1125632055 15:41155104-41155126 TGGGGGAGACAGGTGGGGCGTGG - Intergenic
1127224863 15:56918545-56918567 TGGGGCCGGCAGAGGGGGCGGGG - Intronic
1127306007 15:57706428-57706450 TGGGGTTTACAGAGTTGGCGGGG - Intronic
1129179928 15:73867577-73867599 TGGGGGCCACCGAGGGGGCTGGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129598190 15:76981286-76981308 TTGGGGAGGCAGTGGGGGCGGGG - Intergenic
1130204521 15:81863798-81863820 GGCGGGAGAGAGAGGGGGCGGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132150717 15:99456147-99456169 AGGGAGAAACAGAGGGGACGAGG + Intergenic
1132600774 16:771812-771834 TGCAGGGTTCAGAGGGGGCGGGG + Intronic
1132690521 16:1180066-1180088 CGGGTGATACTGAGGGGGCCGGG + Intronic
1132808827 16:1788060-1788082 CGGGGGTTGCAGAGGGGGCGAGG + Intronic
1132908919 16:2298611-2298633 TAGGGGAGACAGAGAGGGGGTGG - Intronic
1133110751 16:3546713-3546735 AGGGAGGTACAGAGGGGGTGTGG + Intronic
1133271209 16:4611649-4611671 TGGGGGAGACAGAGCGAGCCTGG + Intronic
1133445212 16:5853702-5853724 TGGGGGATAGAGAGGCAGGGTGG + Intergenic
1133875184 16:9727323-9727345 TGGGGGTGACAGAGGGGCTGGGG + Intergenic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1136534853 16:30893523-30893545 TGGGGCACACATGGGGGGCGTGG + Intronic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1136990627 16:35149292-35149314 TGGGGAATCCAGAGGGATCGGGG - Intergenic
1137625483 16:49905371-49905393 TGTGGGAGGCAGAGGGGGAGAGG - Intergenic
1137861203 16:51848635-51848657 GGGGGGATGCAGAGGGGGAGGGG + Intergenic
1139494433 16:67306040-67306062 TGGGGGAGACAGTGTGTGCGTGG + Intronic
1139641889 16:68297517-68297539 TGGGGGCTTCAGAGGGTGGGGGG + Exonic
1140322072 16:73962471-73962493 TGGGGGAGAGAGAGGGGACTTGG + Intergenic
1141436095 16:84000774-84000796 TCTGGGAGACAGAGGAGGCGTGG + Exonic
1141469351 16:84228239-84228261 TGGGAGGGACAGAGGGGGCGAGG - Intronic
1141586627 16:85038130-85038152 TGGGGTGCACAGAGGTGGCGTGG - Intronic
1141697667 16:85627865-85627887 TGGGGGACACAGGGATGGCGGGG - Intronic
1141970347 16:87477756-87477778 AGGGGGATGCGGTGGGGGCGTGG - Intronic
1142263830 16:89054550-89054572 TGGGTGGCACAGAGGGGGCGTGG - Intergenic
1142290800 16:89192899-89192921 TGGCTGGTACTGAGGGGGCGGGG - Intronic
1142377059 16:89711757-89711779 TGGGGGGCAGTGAGGGGGCGGGG - Intronic
1142559801 17:803191-803213 TGGGTGAAACAGACGGGGAGCGG + Intronic
1143095856 17:4477887-4477909 TGGGGAAAACAGAGGAGGGGTGG + Intronic
1143368861 17:6425938-6425960 TGGGGGATACAGAGAGGTTAAGG - Intronic
1143461895 17:7109191-7109213 TGGGAGACGCACAGGGGGCGGGG + Intronic
1143583940 17:7842206-7842228 TTGGGGCTCCAGCGGGGGCGGGG + Intronic
1145869015 17:28258479-28258501 TGGGGCATACAGAGAGGGTGTGG - Intergenic
1146034173 17:29391049-29391071 AGGGGGATATAGAGGGGGGCGGG + Intronic
1146178087 17:30679533-30679555 TGGGGAGGACAGAGGGGGGGAGG + Intergenic
1146262435 17:31430819-31430841 TGTGGGATACAGTGGGAGCATGG + Intronic
1147767128 17:42844731-42844753 TATGGGATACAGAGGGGCAGTGG - Exonic
1147768325 17:42851460-42851482 TGGGAGATACAGAGGGGCAATGG - Exonic
1147923229 17:43931437-43931459 TGGGGCATACAGAGAGGATGTGG + Intergenic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148396521 17:47312391-47312413 AGAGGGATAAATAGGGGGCGGGG + Intronic
1148562770 17:48615345-48615367 AGGGGGAGAGAGAGGGGGAGAGG + Intronic
1149659568 17:58327232-58327254 TGGGGGATACAGGGGGAGTGTGG - Intronic
1150370258 17:64631259-64631281 TGGGGGGGAGAGAGGGGGGGGGG + Intronic
1150675611 17:67244666-67244688 TGGGGGCTGGAGCGGGGGCGTGG - Intronic
1152108759 17:78345435-78345457 TGGGGGCTTCAGAGGGAGCACGG + Intergenic
1152387715 17:79985086-79985108 TGGAGCCTTCAGAGGGGGCGCGG - Intronic
1152538543 17:80963622-80963644 TGAGGGACGCAGAGGGGACGGGG - Intronic
1152538551 17:80963645-80963667 TGAGGGACGCAGAGGGGACGGGG - Intronic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152717722 17:81907859-81907881 TGGGGGACACAGTGGGAGTGGGG + Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1152931844 17:83113967-83113989 TGGGGGGCACAGAGGGGCCCAGG + Intergenic
1153940570 18:9973221-9973243 TGTGGGTTACACAGGCGGCGTGG + Intergenic
1156121394 18:33846909-33846931 TGGGAGGTACAGAGGAGGCAAGG - Intergenic
1157575037 18:48738055-48738077 TGGGGAAGACAGAGGGAGTGGGG - Intronic
1157665891 18:49486786-49486808 TAGTGGAGACAGAGGGAGCGGGG + Intronic
1158105950 18:53885233-53885255 TGGGGGAGAAAGACGGGGTGGGG + Intergenic
1158669740 18:59464086-59464108 TGGTGGAGACAGTGGGGGAGGGG - Intronic
1158859643 18:61579997-61580019 TGGGGGGTCCAGAGGAGGCTTGG + Intergenic
1159329852 18:66978005-66978027 TGGAGCATACACAGGGGGCTGGG + Intergenic
1160070724 18:75625521-75625543 TGGGGGAGACTGAGGGGAGGGGG - Intergenic
1160452879 18:78978002-78978024 AGGGGCATAGAGAGGCGGCGCGG - Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1160586281 18:79915284-79915306 GGGGGGATGCGGAGGGGGTGGGG - Intronic
1160698638 19:496316-496338 TGGGGGCCAAAGATGGGGCGGGG - Intronic
1160775341 19:852795-852817 TGGGGGATCCAGAGGCCCCGTGG + Intronic
1160787409 19:907437-907459 CGGGGAAGTCAGAGGGGGCGGGG + Intronic
1161208925 19:3056362-3056384 TGGGGGAGAGAGAGGGGGAGCGG + Intronic
1161317514 19:3624620-3624642 TGGGGGAGAGGGAGGAGGCGCGG + Intronic
1161366963 19:3885621-3885643 AGGGGGAGACGGAGGGGGAGTGG + Intronic
1161431187 19:4233313-4233335 TGGGGGCGGCAGTGGGGGCGGGG + Intronic
1161468776 19:4446206-4446228 TGGGGGAGTCAGAGCGGGTGGGG + Intronic
1161967248 19:7555426-7555448 TGGGAGAAACCGTGGGGGCGGGG + Intronic
1162130881 19:8525653-8525675 TGGGAGAGCCTGAGGGGGCGGGG - Intronic
1162200288 19:9015085-9015107 TGGCGGAGACAGAGGAGGCAGGG + Intergenic
1162384352 19:10352542-10352564 TGGGGCATACCTAGGGGGAGGGG + Exonic
1162465236 19:10835782-10835804 TAAGAGATCCAGAGGGGGCGGGG - Intronic
1162683054 19:12361671-12361693 AGGGGGAGGCAGAGGGGGAGGGG - Intronic
1162948041 19:14055228-14055250 TGGGGGAGTCAGAGGTGGAGGGG + Intronic
1163496185 19:17647802-17647824 GGTGGGACGCAGAGGGGGCGGGG - Intronic
1163695494 19:18761394-18761416 TGGGGGATGCACTGGGGGTGGGG + Intronic
1164011772 19:21209954-21209976 TGGGGGGGACAGAGGGGCCTAGG - Intergenic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1165132103 19:33639397-33639419 TGGGGGCTGCAGAGGTGGCCAGG + Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1166329394 19:42069652-42069674 TGGGGGGGCCACAGGGGGCGAGG + Intronic
1166802204 19:45465265-45465287 GGTGGCAGACAGAGGGGGCGTGG + Intronic
1166918144 19:46209984-46210006 TGGGGGCTGCAGGGGGGGAGCGG + Intergenic
1166971010 19:46567794-46567816 TGGGGGAAAGAGAGGGAGTGGGG + Intronic
1167050054 19:47072504-47072526 TGGGGGAGGGGGAGGGGGCGGGG + Exonic
1167232891 19:48296651-48296673 TGGGGGATCCACAGGGGGCCAGG + Exonic
1167360861 19:49029720-49029742 AGGGGGATGCAGAGGGAGCCTGG - Intronic
1167365146 19:49050815-49050837 AGGGGGATGCAGAGGGAGCCTGG + Intergenic
1168237268 19:55071335-55071357 TGTGGGTTACAGAGAGGGAGGGG + Intergenic
1168296371 19:55379043-55379065 AGGGGGCCAGAGAGGGGGCGGGG - Intergenic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
1168633465 19:57975428-57975450 TGAGGGAGACAGAGGGGACCTGG + Intergenic
925146079 2:1584355-1584377 TCGGGGACAGAGAGGGAGCGGGG - Intergenic
926316167 2:11711848-11711870 TGGGGATTACAGAGGAGGAGAGG - Intronic
927327903 2:21827591-21827613 TGGGGGAAAGAGAGGGAGGGTGG - Intergenic
927500998 2:23583107-23583129 TGGAGCATCCAGAGGGGGTGTGG + Intronic
928042318 2:27890693-27890715 TCGGGGCCGCAGAGGGGGCGGGG + Exonic
929313355 2:40450971-40450993 GGGGGGATAGAGAAGAGGCGGGG + Intronic
930123138 2:47776173-47776195 TGGGGGATAGAGAGATGGGGAGG - Intronic
930466269 2:51754299-51754321 AGGGAGATACGGAGAGGGCGAGG + Intergenic
931081133 2:58772404-58772426 TGAGGAATACAGAGGGAGTGAGG + Intergenic
931890950 2:66671402-66671424 TGGGGGAGGCAGAGGGGAAGGGG + Intergenic
932363525 2:71130285-71130307 GGCGGGAGGCAGAGGGGGCGGGG + Intergenic
932744922 2:74325989-74326011 TGTGAGAAACAGAGGGGGCCTGG + Intronic
933234498 2:79850216-79850238 AGAGAGATACAGAGGGAGCGAGG - Intronic
934969462 2:98751204-98751226 TGGGAGAGACAGTGGGGGTGGGG - Intergenic
935728408 2:106044130-106044152 TGGGGGAGACAGAGCTGGGGAGG + Intergenic
935884217 2:107597944-107597966 TGGGGGAGAGGGAGGGGGCCTGG - Intergenic
936376558 2:111946097-111946119 TGGGGAAGACAGAGGGGAGGGGG + Intronic
937653495 2:124347351-124347373 TCTGGGAGACTGAGGGGGCGGGG + Intronic
938698796 2:133858384-133858406 TGGGGGAAAGAGAGGGAGAGAGG + Intergenic
942154227 2:173110568-173110590 TGGGGGAAAGAGTAGGGGCGGGG - Intronic
942198487 2:173546633-173546655 TGGGGGATAGGGAGGGGCAGGGG + Intergenic
942497469 2:176554606-176554628 TGGGCGATAAGGAGGGGGAGGGG - Intergenic
1169488244 20:6051450-6051472 TGGGGAATACCGAGGGGAAGGGG - Intronic
1170226434 20:13995845-13995867 TGGGGGTTAGGGTGGGGGCGGGG + Intronic
1171197485 20:23211524-23211546 TGGAGGAAAGAGAGGGAGCGTGG - Intergenic
1171893612 20:30740734-30740756 TGCGGTCTACAGAGGGGGTGGGG + Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172528704 20:35616517-35616539 TGGGTGCCACTGAGGGGGCGCGG + Intronic
1172778967 20:37424554-37424576 TGTGGGAGACAGAGGGAGCCAGG + Intergenic
1173970111 20:47146075-47146097 TGGGGGAGAGAGAGGTGGCAAGG + Intronic
1174181820 20:48679841-48679863 TGGGAGGGGCAGAGGGGGCGTGG - Intronic
1174373873 20:50112821-50112843 TGGGGGAGCCGGAGTGGGCGAGG - Intronic
1174575521 20:51534234-51534256 TGGGGGCTGCAGCGGGGGCCAGG + Intronic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1180079504 21:45480329-45480351 TGGGGGCAGCAGAGGGGCCGTGG + Intronic
1180095328 21:45553712-45553734 TGGGGGATTGGGAGGGGGTGTGG - Intergenic
1180095338 21:45553732-45553754 TGGGGGATTGGGAGGGGGTGTGG - Intergenic
1180095357 21:45553772-45553794 TGGGGGATTGGGAGGGGGTGTGG - Intergenic
1180095367 21:45553792-45553814 TGGGGGACTGGGAGGGGGCGTGG - Intergenic
1180095377 21:45553812-45553834 TGGGGGACTGGGAGGGGGCGTGG - Intergenic
1180095387 21:45553832-45553854 TGGGGGACTGGGAGGGGGCGTGG - Intergenic
1180095446 21:45553954-45553976 TGGGGGATTGGGATGGGGCGTGG - Intergenic
1180095491 21:45554053-45554075 GGGGGGATTGGGAGGGGGCGCGG - Intergenic
1180095523 21:45554117-45554139 TGGGGGATTGGGAGGGGGTGTGG - Intergenic
1180095533 21:45554137-45554159 TGGGGGACTGGGAGGGGGCGTGG - Intergenic
1180095543 21:45554157-45554179 TGGGGGATTGGGAGGGGGCGTGG - Intergenic
1180095553 21:45554177-45554199 TGGGGGACTGGGAGGGGGCGTGG - Intergenic
1180095581 21:45554237-45554259 TGGGGGATTGGGATGGGGCGTGG - Intergenic
1180095607 21:45554296-45554318 TGGGGGACTGGGAGGGGGCGCGG - Intergenic
1180095617 21:45554316-45554338 TGGGGGATTGGGAGGGGGCGTGG - Intergenic
1180095627 21:45554336-45554358 CGGGGGATTGGGAGGGGGCGTGG - Intergenic
1180095637 21:45554356-45554378 GGGGGGATTGGGAGGGGGCGCGG - Intergenic
1180095658 21:45554398-45554420 TGGGGGATTGGGAGGGGGCGTGG - Intergenic
1180095955 21:45555362-45555384 TGGGGGTTGCAGGGGCGGCGGGG + Intergenic
1180561372 22:16617413-16617435 TGGAGGATAGAGAGGGTGAGTGG - Intergenic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181593036 22:23896316-23896338 TGGGGGAGACATGGGGGGCATGG + Intronic
1182357321 22:29728192-29728214 GGTGGGATAAAGAGGGGGCTTGG - Intronic
1182529811 22:30946604-30946626 TGGGGGATGGAGAGGGAACGAGG - Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183598126 22:38824454-38824476 TGGGAGGTACAGAGGCTGCGAGG + Intronic
1183702192 22:39457149-39457171 AGGGGGTTGCGGAGGGGGCGGGG + Intergenic
1183726699 22:39593972-39593994 TGGGGGATACCGAGGATGCTGGG + Intronic
1184478041 22:44732006-44732028 TGGGGGATTCACAGGGAGGGAGG - Intronic
1184538157 22:45101540-45101562 AGGGGGAGACAGAGTGGGTGAGG - Intergenic
1184993342 22:48185063-48185085 TGGAGGTTTCAGAGGGAGCGTGG + Intergenic
1185035576 22:48475039-48475061 TGTGGGAGGCAGAGGGGGCGAGG - Intergenic
1185035592 22:48475077-48475099 TGCGGGAGGCAGAGGGGGCGAGG - Intergenic
1185242083 22:49752049-49752071 TGAGGAAGACAGAGGGGGAGTGG + Intergenic
1185345490 22:50308774-50308796 TGGGGGAAGCAGAGGAGGAGGGG - Intergenic
950315506 3:11998402-11998424 TGGGGTATACTGCGGGGGAGGGG + Intergenic
950448476 3:13052178-13052200 AGGGGGCTACAGAGGGTGCCCGG - Intronic
950626775 3:14253133-14253155 TGGGGGCAACAGAGGGGGTAGGG + Intergenic
950880442 3:16318725-16318747 TGGGGGATACAGGGTGGGAAAGG - Intronic
954327099 3:49869657-49869679 TGCGGGATGCAGAGTGCGCGGGG - Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
955376586 3:58402253-58402275 GGGGGGAGAGAGAGGGGGAGGGG - Intronic
956435149 3:69227896-69227918 TAGGGGAAACAGTGGGGGTGGGG + Intronic
960350727 3:116589547-116589569 AGGGGACTACAGAGGGGGTGGGG - Intronic
961510284 3:127396617-127396639 GGAGGAATGCAGAGGGGGCGGGG + Intergenic
961917607 3:130393364-130393386 TGGGGGATACAGTGGGGACACGG - Intronic
961993896 3:131220688-131220710 TGGGGCAGACAGAGGGTGGGTGG - Intronic
962204461 3:133423553-133423575 TGGGGGAGGCGGCGGGGGCGGGG + Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
965135567 3:164762839-164762861 TGGGGGATAAATAGGGGTTGAGG - Intergenic
965596803 3:170418831-170418853 CGGGGCTTAAAGAGGGGGCGGGG + Intergenic
967249585 3:187523125-187523147 TGGGGGAAAGAGAGGGGAAGAGG - Intergenic
967932223 3:194698394-194698416 TGGGGGATAAAGTGGGGGGCTGG + Intergenic
968334906 3:197905092-197905114 TGGGGGATGCGGAGGGTGTGGGG + Intronic
968693409 4:2008452-2008474 TGGGGGATTCCCAGGGGGCGAGG + Intronic
968916658 4:3499707-3499729 GAGGGGATGCAGAGGGAGCGTGG + Intronic
969239904 4:5891091-5891113 GGGGAGATACAGAAGGGGTGGGG + Intronic
969467516 4:7366470-7366492 TGGGGGAGAGAGGGGGGGAGGGG - Intronic
969554110 4:7894590-7894612 TCAGGGAGACAGAGGGGGCCTGG + Intronic
971371943 4:26027078-26027100 TGGCAGATACAGAGGGAGTGAGG + Intergenic
971774921 4:30950806-30950828 TGAGGGAGACAGAGGGGACTAGG + Intronic
972740973 4:41885703-41885725 TGGGGGATAAGGAGAGGGCTTGG + Intergenic
975036484 4:69690507-69690529 TGGGGGGTATAAAGAGGGCGTGG - Intergenic
975481461 4:74885226-74885248 TGGTGGGTAAAGAGGGTGCGTGG + Intergenic
976046276 4:80951987-80952009 TGGGGGCCAGAGAGTGGGCGAGG + Intronic
976177914 4:82373382-82373404 GGGGGAATAAAGAGGGGGAGGGG + Intronic
978735119 4:112076681-112076703 TGGTGGATGCAGAGAGGTCGTGG - Intergenic
980737325 4:136907514-136907536 TGGGGGCCAAGGAGGGGGCGAGG - Intergenic
985709048 5:1417918-1417940 TGGGTGCTGCAGAGGGGGCGGGG + Intronic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
986622171 5:9687507-9687529 TGGGAGAGACAGTGGGGGTGGGG - Intronic
989523058 5:42423688-42423710 TGGGGAGGAGAGAGGGGGCGGGG - Intergenic
992742751 5:79790557-79790579 TGGGGGATACAGGCCGGGTGAGG - Intronic
994670031 5:102754115-102754137 TGGGAGAAAGAGAGGGGGCTGGG + Intronic
996747578 5:126858388-126858410 CGGGGGCTACAGAAGGTGCGGGG + Intergenic
997474161 5:134133145-134133167 TGGGGGAGACAGAGGGGCAAAGG + Intronic
997657562 5:135566718-135566740 TGGGGGATTTAGAGGAGGCCCGG - Intergenic
999061022 5:148635355-148635377 TTGTGGATAGAGAGGGGGAGTGG + Intronic
999257136 5:150216001-150216023 AGGGGGATACAGGGTGAGCGTGG + Intronic
1001207961 5:169781771-169781793 TGGGGGCGGGAGAGGGGGCGTGG - Intronic
1001381789 5:171310494-171310516 TGGGGGAGGCAGAGGGGGGCGGG - Intronic
1001396127 5:171420514-171420536 TGGGGCACAGGGAGGGGGCGCGG - Intronic
1001808157 5:174606759-174606781 TGGTGGATCCAGAGGGAGAGTGG - Intergenic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1002415307 5:179117394-179117416 TGGGGGAGACAGTGAGGGAGTGG - Intronic
1002565797 5:180112576-180112598 TGGGTGACACAGTGGGTGCGAGG - Intronic
1002812073 6:640259-640281 TGGGAGAGACAGAAGGGGTGCGG + Intronic
1003182976 6:3807714-3807736 TGGGGGAGACACAGGGGAGGAGG - Intergenic
1003426173 6:5999679-5999701 GGAGGGAGACAGAAGGGGCGAGG - Intronic
1004458782 6:15816678-15816700 TGGGGGAGACTGATGGGGAGTGG + Intergenic
1006388221 6:33744077-33744099 TGGGGGAGGCAGAGGCTGCGAGG + Intronic
1006738453 6:36291574-36291596 GGAGGGACACGGAGGGGGCGGGG + Intronic
1007628534 6:43259888-43259910 TGGGGGATCCAGAGAGGTCCCGG + Intronic
1007725859 6:43915227-43915249 TGGGGAATAGAGAGGTGGCTGGG - Intergenic
1009545487 6:65014536-65014558 TGTGGGATACAGAAGGGGATGGG + Intronic
1009760519 6:67998929-67998951 TGGGGGAGAGAGAGGAGGAGAGG - Intergenic
1011287560 6:85741187-85741209 TGGGGGAAAGAGAGGGAGTGGGG - Intergenic
1014033977 6:116743940-116743962 TGGGGGATATGGAGGGGATGAGG - Intergenic
1015441892 6:133258194-133258216 TGGGGCATAGAGTGGGGACGAGG + Intronic
1016472002 6:144384461-144384483 TGGGGGAGGCAGTGGGGGAGTGG - Intronic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1017770739 6:157642588-157642610 TGGGGGAGACAGAGGTGCAGTGG + Intronic
1017872933 6:158502212-158502234 TGGGGGCGGCAGAGGGGGCGGGG - Exonic
1018067051 6:160131599-160131621 TGGGGGTGGCAGAGGGGACGGGG + Intronic
1019030008 6:169001799-169001821 TGGGGCATGCAGAGGAGGAGGGG + Intergenic
1019379281 7:712646-712668 TGGGGGATGGGGCGGGGGCGGGG - Intronic
1019740718 7:2671569-2671591 CGGGGGAGGCAGAGGGTGCGTGG + Intergenic
1020204778 7:6105534-6105556 TTAGGGATGCAGTGGGGGCGGGG - Intronic
1020283626 7:6664052-6664074 GGGGGGCTGCAGAGCGGGCGCGG + Intergenic
1022174719 7:27862062-27862084 GGGAGGATACAGAGGGGGAAAGG + Intronic
1022411751 7:30144081-30144103 TGGGGGAGACAGAGGGGAAGGGG - Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023863080 7:44227032-44227054 TGTGGAAGACAGAGGGGGTGTGG + Intronic
1029174876 7:98657609-98657631 TGGGGCCTTCAGAGGGAGCGCGG + Intergenic
1029634447 7:101774597-101774619 TTTGGGAGGCAGAGGGGGCGTGG + Intergenic
1033801814 7:144910659-144910681 TGGTGGATACAGAGGGGAGTGGG - Intergenic
1034277616 7:149830567-149830589 TGGGGGGGACAGAGGAGGAGGGG - Intergenic
1034622042 7:152463940-152463962 AGGGTGATACCGAGAGGGCGGGG + Intergenic
1035067741 7:156120652-156120674 AGGGAGATACAGAGATGGCGAGG + Intergenic
1035067751 7:156120713-156120735 CGGGAGATACAGAGATGGCGAGG + Intergenic
1035069511 7:156131621-156131643 TGAGGGTTACAGAGAGGGCGAGG - Intergenic
1035253797 7:157613644-157613666 TGTGGGAGACGGAGGCGGCGGGG - Intronic
1036763861 8:11533644-11533666 TGGAGGAGACGGAGGGGGAGAGG + Intronic
1038563801 8:28602766-28602788 TGGGGGATACTGACTGGGAGGGG - Intronic
1038616360 8:29099157-29099179 GGGGAGAAACAGAGAGGGCGGGG + Exonic
1038963547 8:32548191-32548213 TGGGGAAGAGGGAGGGGGCGAGG + Intronic
1041118241 8:54561066-54561088 TGGGGGATATACTGGGGGGGTGG + Intergenic
1042229783 8:66544071-66544093 TGGGGGATACAGAGCGGGCTTGG + Intergenic
1042589893 8:70387695-70387717 TGGGGGATAGAGGGGGAGGGCGG + Intronic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1045471308 8:102514591-102514613 TGGGTGATACAGAGGCTGCTTGG + Intergenic
1045543316 8:103106265-103106287 TGTGGGAGCCAGAGGTGGCGGGG + Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1047285309 8:123482795-123482817 TGGGGTATACAGAGTTGGGGGGG + Intergenic
1047969286 8:130070960-130070982 AGGGGGAGAGAGAGGGGGAGGGG + Intronic
1048247871 8:132829102-132829124 TGGGGAATACAGACAGGGTGCGG + Intronic
1049568999 8:143359675-143359697 GGGGGGACACAGAGGAGGAGGGG + Intronic
1052427558 9:28325084-28325106 TGGGGGATAGGTAGGGGGAGAGG - Intronic
1053312205 9:37027064-37027086 TGGCGGAGACCGAGGGGTCGAGG - Intronic
1055442541 9:76350907-76350929 GGGGGAATACAGAGTGGGAGAGG + Exonic
1056121756 9:83495195-83495217 TGGGGGACAAAGAGGGGAGGAGG + Intronic
1056137635 9:83645992-83646014 TGGGGGATGCAGAGCAGGAGGGG + Intergenic
1056408121 9:86296432-86296454 TGGGGGATAGAGGGGGAGGGAGG + Intronic
1056604943 9:88077853-88077875 AGAGGGAGACAGAGGGAGCGGGG + Intergenic
1058585862 9:106505426-106505448 TGGAAGATACACGGGGGGCGGGG + Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059653295 9:116334834-116334856 CAGGGGAGACAGAGGGGCCGAGG - Intronic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1060804230 9:126564605-126564627 TGCGGGACACAGACGGGGAGAGG - Intergenic
1061181471 9:129027516-129027538 TGGGGGATGGAGAGAGGGCTGGG - Intronic
1061866032 9:133492161-133492183 TGGGGGAGACTGGGGGAGCGAGG + Intergenic
1061886565 9:133593933-133593955 TGGGGGTGGCAGAGGGGGAGTGG - Intergenic
1062526591 9:136980353-136980375 TGGGGGAGGCAGAGGGGAGGAGG + Intronic
1062656153 9:137605440-137605462 CGGGGAATAACGAGGGGGCGGGG + Intergenic
1062691145 9:137842399-137842421 TGGAGGATACGGAGGGGGGACGG - Intronic
1062691189 9:137842529-137842551 TGGATGATACAGAGGGGGGATGG - Intronic
1062691222 9:137842631-137842653 TGGATGATACAGAGGGGGGACGG - Intronic
1185604389 X:1359503-1359525 AGGGAGATACAGAGAGGGGGAGG - Intronic
1186502200 X:10060435-10060457 TGGGGGGTGCAGAGGGGCGGTGG + Intronic
1186898559 X:14029835-14029857 TTGGAGAGACAGAGGGGGAGTGG + Exonic
1187546684 X:20261143-20261165 TGGGGGTTACAGAGGGGGTGGGG + Intronic
1190326443 X:49209814-49209836 TGGTGGGTAGAGAGGCGGCGAGG - Intronic
1194270712 X:91811206-91811228 TGGGGGATAAAAAGAGGGAGGGG - Intronic
1195618433 X:106930780-106930802 TGGGGGATACAGAGAGGTCTAGG - Exonic
1196746765 X:119078081-119078103 TGGAGAATAAAGAGGGGGTGTGG - Intergenic
1198127593 X:133661634-133661656 AGGGGGAGAGAGAGGGGGGGGGG - Intronic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1200078507 X:153564114-153564136 TGGGGGCTAGAGAGGGTGGGAGG - Intronic
1200230948 X:154443722-154443744 TGGAGGAAGCAGAGGGAGCGGGG + Intergenic
1200587944 Y:5032639-5032661 TGGGGGATAAAAAGAGGGAGGGG - Intronic