ID: 954574357

View in Genome Browser
Species Human (GRCh38)
Location 3:51667410-51667432
Sequence CATCACTGGGAGGCCGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2938
Summary {0: 1, 1: 6, 2: 189, 3: 631, 4: 2111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954574357_954574366 6 Left 954574357 3:51667410-51667432 CCCTCCTCGGCCTCCCAGTGATG 0: 1
1: 6
2: 189
3: 631
4: 2111
Right 954574366 3:51667439-51667461 CAGGCGTGAGCCACTGCTCCTGG 0: 627
1: 19001
2: 82797
3: 123587
4: 133881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954574357 Original CRISPR CATCACTGGGAGGCCGAGGA GGG (reversed) Exonic
Too many off-targets to display for this crispr