ID: 954574371

View in Genome Browser
Species Human (GRCh38)
Location 3:51667464-51667486
Sequence CTGAGAAATCAAAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 2, 3: 93, 4: 518}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954574371_954574379 27 Left 954574371 3:51667464-51667486 CCCACTTCCTTTTGATTTCTCAG 0: 1
1: 0
2: 2
3: 93
4: 518
Right 954574379 3:51667514-51667536 CTTCTGTGCACCCAGCTCAGTGG 0: 1
1: 2
2: 1
3: 35
4: 240
954574371_954574374 3 Left 954574371 3:51667464-51667486 CCCACTTCCTTTTGATTTCTCAG 0: 1
1: 0
2: 2
3: 93
4: 518
Right 954574374 3:51667490-51667512 AGTCTTTCCCTTCTGAGCCATGG 0: 1
1: 0
2: 4
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954574371 Original CRISPR CTGAGAAATCAAAAGGAAGT GGG (reversed) Exonic
900855909 1:5183742-5183764 CTCAAAATTCAAAAGGAACTGGG - Intergenic
901220808 1:7582838-7582860 CTGAGGAACCAGAAGGAAATGGG + Intronic
901228837 1:7630787-7630809 CTGAGCACTGACAAGGAAGTGGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
902276509 1:15343810-15343832 CAGAGAAGAAAAAAGGAAGTCGG - Intronic
903104444 1:21063244-21063266 CTGAAAAATCAAAAGTAACCAGG + Intronic
903107638 1:21097519-21097541 TTGAAAAACCAAAAGGAAGGGGG + Intronic
903777668 1:25803364-25803386 TTGAGAAATCAAAGGGCAGGGGG + Intronic
904057302 1:27679912-27679934 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
904887433 1:33751474-33751496 CTCAGAAATCAGAATGGAGTGGG + Intronic
904999048 1:34653793-34653815 TTGAGAAAACAAAGGGACGTGGG + Intergenic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905349230 1:37333135-37333157 CTTAGACATCAGAAGGAAGCTGG - Intergenic
905965313 1:42088544-42088566 CTGGGAATTTAAAAGCAAGTGGG + Intergenic
906016632 1:42587639-42587661 CTGAGAAATCAACAGGTTATTGG - Intronic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
906832168 1:49044493-49044515 CTCAAAAAAAAAAAGGAAGTAGG + Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907177465 1:52538364-52538386 CTGAGAAAAAAAAAGGGAGCTGG + Intronic
907322717 1:53615582-53615604 CTGAGAAGTTTAAAGGATGTTGG - Intronic
907590117 1:55658513-55658535 CTGAGAAATGAAAAGGATTTAGG + Intergenic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
908713249 1:67041776-67041798 CTGAGAAAAAAAAAACAAGTTGG + Intronic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
910388162 1:86706380-86706402 CTTAGAAATCAAAAGCTAGAAGG - Intronic
910715628 1:90226157-90226179 CTGTAAAGTCAAAAGCAAGTTGG - Intergenic
910921266 1:92350086-92350108 GTGAGAAACCTAAATGAAGTGGG - Intronic
911235218 1:95404772-95404794 CTGTAAAATCAAAAACAAGTTGG - Intergenic
911985387 1:104616272-104616294 CTTTAAAATCAAAAGCAAGTTGG + Intergenic
912228783 1:107767934-107767956 CTGGTAAATCATAAGGAAGTAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913345269 1:117803005-117803027 CTTAGAAATCAAAAGCCACTTGG + Intergenic
913396277 1:118375966-118375988 CTGTAAAATCAAAAGCAAATTGG + Intergenic
914461939 1:147892816-147892838 CTGAGAAAAGAAAACGAAGTGGG + Intergenic
914812863 1:151041972-151041994 CTCAGAAAAAAAAAGGAAATAGG + Intronic
916432955 1:164749824-164749846 CTGACAGATCAAGAGGATGTGGG + Intronic
917070029 1:171140549-171140571 CTGAGAAATGAAAACCAAATGGG + Intronic
917128874 1:171718831-171718853 CTGAGAAAATAAAATGAATTAGG + Intronic
918145672 1:181753686-181753708 ATGAGAATTCAATAGGAAGTGGG - Intronic
918327680 1:183425942-183425964 CTGAGAAATTCAGATGAAGTTGG - Intergenic
918368232 1:183832181-183832203 CTGAGGAATGAGAATGAAGTGGG + Intronic
918558950 1:185841169-185841191 CTGATAAATCACTAGGAAATGGG + Intronic
918596866 1:186304638-186304660 CTGACAGATTAAAAGGCAGTTGG + Intronic
918657214 1:187042911-187042933 CTCATAAATCAAAAGGAAAATGG + Intergenic
919242803 1:194936426-194936448 CTGCAAAATCAAAAGCAAGTTGG - Intergenic
919371840 1:196738420-196738442 CTGTAAAATCAAAAGCAAGTTGG + Intronic
919394267 1:197024585-197024607 CTGTGCAATCAAAAGGAAAGTGG - Intergenic
920540728 1:206776042-206776064 CTGGGAAATCAGAAGGTTGTGGG + Intergenic
920703560 1:208235624-208235646 GTGAGAAATCTTTAGGAAGTGGG + Intronic
921161644 1:212476931-212476953 CTGAAAAATAAAAAAGAAATGGG - Intergenic
921305766 1:213795149-213795171 CAGAGAAATCAATAGGTAGATGG - Intergenic
921554448 1:216581184-216581206 CTTAAAAATCAAAAGGCATTTGG + Intronic
922087453 1:222364387-222364409 AAGAGCAATGAAAAGGAAGTAGG + Intergenic
923058196 1:230445288-230445310 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
923277313 1:232408251-232408273 CTAAGAAGGCAAAAGTAAGTTGG - Intronic
924415540 1:243852152-243852174 CTTAAAAATAAAAAGCAAGTTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065027327 10:21551223-21551245 CTTAGAAATCAAAGATAAGTTGG - Intronic
1066365428 10:34771558-34771580 CTGAGAAAGAAAAATGACGTCGG + Intronic
1066583126 10:36902149-36902171 CTGAGAAACTAAAAAGAAGCAGG - Intergenic
1067415988 10:46103570-46103592 TGGGGAAACCAAAAGGAAGTGGG - Intergenic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068797251 10:61097187-61097209 ATGAGAAAGGAAAAGGAAGTGGG - Intergenic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1070941099 10:80347894-80347916 CTAAGAAAGAAAAACGAAGTTGG - Intronic
1071942111 10:90601496-90601518 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1072038863 10:91589203-91589225 CTGAGAATTCTAAGGGAAGAGGG + Intergenic
1072044603 10:91642436-91642458 ATGACAAATGAAAATGAAGTCGG - Intergenic
1072070808 10:91914872-91914894 CTGAGAAAGTAAAACAAAGTTGG - Intergenic
1072242042 10:93505753-93505775 CAGAGAAATAAAAGAGAAGTGGG - Intronic
1074624614 10:115167341-115167363 TTGAGAAATAAAAACAAAGTAGG - Intronic
1075376486 10:121981994-121982016 CTAGGAAATCTAAAGCAAGTTGG - Intergenic
1077773583 11:5247596-5247618 CTGTGAGATCAAAATGTAGTGGG - Intergenic
1078683327 11:13501531-13501553 CTGACAGATCAAAAGGAGCTTGG - Intergenic
1078727650 11:13945976-13945998 AGGAGAAATAAAAAGGAGGTAGG - Intergenic
1080181022 11:29426418-29426440 CTGAGAAGCCAAAAAGAGGTTGG + Intergenic
1080192680 11:29570544-29570566 CTGTAAAATCAAAAACAAGTTGG + Intergenic
1080322692 11:31032248-31032270 CTCAGAAATCAAAAGGATATAGG + Intronic
1080380603 11:31768067-31768089 TTCAGAAATCAAAAGGAAAATGG + Intronic
1080946228 11:36978466-36978488 CTGTAAAATAAAAAGCAAGTTGG + Intergenic
1080947745 11:36993965-36993987 CTGAGAAATGCAAAGGAAGTTGG + Intergenic
1081181761 11:39992660-39992682 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1081416008 11:42817150-42817172 CTGATAAATCAAAATGTATTGGG + Intergenic
1081942423 11:46955296-46955318 ATTAGAAATTAAAAGTAAGTAGG + Intronic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1085201820 11:74706543-74706565 CTGAAAACTCAAAGGGAAGCTGG + Intronic
1085819128 11:79773132-79773154 CTGAGTAATCAGAAGGGATTTGG - Intergenic
1085941486 11:81210933-81210955 CTTAGTAATCAATAGCAAGTGGG - Intergenic
1086045554 11:82527352-82527374 GGCAGAAATCACAAGGAAGTGGG - Intergenic
1087255197 11:95945450-95945472 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1087954722 11:104271466-104271488 CTGAGAAATGAATAAGAAGGAGG + Intergenic
1089019403 11:115197115-115197137 CTGAGAAAGCAAAACGAACTTGG - Intronic
1089080945 11:115775846-115775868 TTGAGAAATCAAATGGAGGTAGG + Intergenic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1089626389 11:119753800-119753822 GTGAGAAAGAAAAGGGAAGTAGG + Intergenic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090824580 11:130375380-130375402 CTGAGAACTCTAAAGGATGGGGG - Intergenic
1091220314 11:133926696-133926718 CTGAAAAAGCAACAGGAATTCGG + Intronic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1092951712 12:13509758-13509780 CTGAGAAACCAAAGGAAAGCTGG + Intergenic
1092994182 12:13932776-13932798 CTCAGAAATCAGGATGAAGTAGG + Intronic
1093150944 12:15620481-15620503 ATGAGTAGTTAAAAGGAAGTGGG - Exonic
1093360741 12:18224274-18224296 ATGAAAAATCAAAAGGTATTTGG - Intronic
1093398211 12:18709458-18709480 CTGAGAAATGAAAACAAAGTTGG - Intronic
1093965679 12:25322524-25322546 AAGAGAATTCAACAGGAAGTAGG + Intergenic
1094308251 12:29046353-29046375 CTGAGAAAGAAAAACGAAGTTGG + Intergenic
1094697414 12:32834238-32834260 CTGAGATTTCAAAAGGGAATGGG - Intronic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1096609368 12:52790877-52790899 TTGAGAAAGCAAGAGAAAGTGGG + Intronic
1097549113 12:61044683-61044705 CTTAAAAATATAAAGGAAGTGGG + Intergenic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1097787315 12:63775513-63775535 CTGATAAATCCAAAGATAGTTGG + Intergenic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1097983454 12:65757940-65757962 ATGAGAAATCTAAAGAAAGAAGG + Intergenic
1098483494 12:70994102-70994124 CACAGAAATCAAAAAGAAGAGGG + Intergenic
1098628267 12:72699316-72699338 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1099635292 12:85204754-85204776 CTGTAAAATCAAAAGCAAGCTGG - Intronic
1099801305 12:87460289-87460311 CTGTAAAATCAAAATCAAGTTGG + Intergenic
1099975351 12:89540812-89540834 CTGTGAAATCAAAAGGCAAGAGG + Intergenic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100427600 12:94501733-94501755 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1101000056 12:100348482-100348504 CTCAGAATTCAAAAGGACTTTGG - Intergenic
1101098114 12:101364599-101364621 CACAGAAATCAATAGGAAGGTGG - Intronic
1102630321 12:114272738-114272760 CTGAGAGAATAAAAGGAATTTGG - Intergenic
1102991782 12:117321308-117321330 ATGAGAAATCAAAAATAAATAGG - Intronic
1105245921 13:18650230-18650252 ATGAGAAAGCAAAAAGGAGTGGG - Intergenic
1105695888 13:22888247-22888269 CTGAGAATTCATCAGGAACTGGG - Intergenic
1105893654 13:24700001-24700023 TTGAGAAATCAAACGCAAGTGGG - Intronic
1106190403 13:27447838-27447860 CTTAGAAATAAAAAGGAACAAGG - Intronic
1106408476 13:29494736-29494758 CTTAAAAATAAAATGGAAGTAGG + Intronic
1106718876 13:32418919-32418941 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1107159828 13:37212510-37212532 CTTAGAACTGAAAAGTAAGTGGG - Intergenic
1107617293 13:42182844-42182866 CTGAGAAAACTAAGGGAAATGGG - Intronic
1108225296 13:48283439-48283461 TAGAGAAATCAAAAGGCAGTTGG + Intergenic
1109421577 13:62118916-62118938 CCTAGAAATAAAAAAGAAGTAGG + Intergenic
1109870103 13:68322604-68322626 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1110084153 13:71355995-71356017 ATGAGAAAGTAAAAGGAAATAGG - Intergenic
1110099904 13:71585648-71585670 CTGAGAAGTCAGAAGGAATTAGG + Intronic
1110440648 13:75521759-75521781 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1111036086 13:82676730-82676752 CTGTAAAGTCAAAAGCAAGTTGG + Intergenic
1111038897 13:82717855-82717877 TTGAGAAATAAAAAGGATGATGG - Intergenic
1111528171 13:89500905-89500927 ATAAGAAATCATAAGTAAGTGGG - Intergenic
1112824974 13:103381827-103381849 CTGTAAAATTAAAAGCAAGTTGG + Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1112965184 13:105182017-105182039 CTCCAAAATCAAAAGGAAATGGG - Intergenic
1113070633 13:106417351-106417373 CTTATAAAACAAAAGGAATTTGG - Intergenic
1113648712 13:112017316-112017338 CTGAGAAATAAAAACAAATTTGG - Intergenic
1114052366 14:18931239-18931261 CTGAGAAATAGAAACTAAGTTGG - Intergenic
1114054407 14:18954228-18954250 CTGAGAAATAGAAACTAAGTTGG - Intergenic
1114108146 14:19447704-19447726 CTGAGAAATAGAAACTAAGTTGG + Intergenic
1114110192 14:19470686-19470708 CTGAGAAATAGAAACTAAGTTGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1117057462 14:51927707-51927729 CTGAGATTTGAAAAGAAAGTAGG + Intronic
1117360090 14:54964342-54964364 TTTAGAAATAAAAAGGAAGCCGG + Intronic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1117461495 14:55949666-55949688 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
1117962381 14:61176193-61176215 CTGAGAAATCAATAAGAATAAGG - Intergenic
1118046413 14:61975961-61975983 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1118313938 14:64713757-64713779 CAGAGAAAAAAAAAGGAAATGGG - Intronic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119189641 14:72671907-72671929 CACTGAAAGCAAAAGGAAGTTGG + Intronic
1120291339 14:82575245-82575267 CTGAGAAAACAAAAAGAAAAAGG + Intergenic
1121525869 14:94618948-94618970 ATGAGAAATCAATAGGAACCAGG - Intronic
1121695855 14:95911297-95911319 CTGAGACATCAAAGGCCAGTAGG - Intergenic
1121821205 14:96968014-96968036 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1122926965 14:104908235-104908257 TTCAGAATTCAGAAGGAAGTTGG + Intergenic
1124664515 15:31581018-31581040 CTGTAAAATCAATAGCAAGTTGG + Intronic
1124793974 15:32758382-32758404 GAGAGAAATTAGAAGGAAGTAGG - Intergenic
1126397875 15:48238499-48238521 AGGAGAAATCAAAAGACAGTGGG + Intronic
1126628730 15:50712291-50712313 CTAAGAAATTAGAAGGAAGTAGG - Intronic
1126748840 15:51854960-51854982 GTGATAAATGAAAAGGAAGATGG + Intronic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127261535 15:57330183-57330205 CTGTGAAAACCACAGGAAGTGGG - Intergenic
1128147404 15:65339611-65339633 CTGAGCAAACATGAGGAAGTGGG + Intronic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1129022121 15:72529749-72529771 CTCAGAAAACAAAACTAAGTGGG + Intronic
1129961314 15:79687940-79687962 CTAAGAAATCTAGAGTAAGTCGG + Intergenic
1130425023 15:83788567-83788589 CTGAGAAATCTAAAGGCATCTGG + Intronic
1131302827 15:91214673-91214695 CGATGAAATCAAAACGAAGTAGG + Intronic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131776902 15:95812355-95812377 CTGAGAAGTACAAAGGAAGGAGG - Intergenic
1133407512 16:5537036-5537058 GTGAGTACTCAAAAGGAAGTGGG - Intergenic
1133830176 16:9315693-9315715 CTGTGACATCAAAAGGGAGACGG + Intergenic
1135392883 16:22108504-22108526 CTGAGAAAACAAAAACAAATTGG - Intronic
1135591769 16:23710306-23710328 CTGAGAAATTGGAAGGAATTTGG - Intronic
1135627368 16:24007806-24007828 TGGAGAAATCAAAAGGCAGATGG + Intronic
1136559493 16:31030726-31030748 CTGAGAAACAAAGAGGAAGATGG + Intergenic
1136674693 16:31892576-31892598 CTGTAAAATCAAAAGCAAGTTGG + Intronic
1136915342 16:34186877-34186899 CTGGTCAATCAAAAGAAAGTTGG + Intergenic
1136915433 16:34188588-34188610 CTGGTCAATCAAAAGAAAGTTGG + Intergenic
1137244974 16:46694855-46694877 CTTAGAAAACAAAATGTAGTTGG + Intronic
1137382108 16:48009133-48009155 CTGACAAAGAAAAAGGAAGCAGG + Intergenic
1138767198 16:59618465-59618487 CTGATAAATCATAAGGCAGCAGG - Intergenic
1140344963 16:74204131-74204153 ATTAGAATTCAAAAGGAAATGGG - Intergenic
1140963302 16:79938644-79938666 CTGTCAAATAAAAAGGAAGCTGG - Intergenic
1141108937 16:81256276-81256298 CTAAGATATCAAAAGGCACTGGG + Intronic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141868280 16:86766061-86766083 CAAAGAAATCAAAACGAAGGAGG - Intergenic
1143387357 17:6539121-6539143 CTGAGACATCAAAAGGACAGAGG + Intronic
1144033509 17:11342848-11342870 TTGAAAAATCCACAGGAAGTGGG - Intronic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1146953473 17:36922229-36922251 CTGAGAGAACAAATGGGAGTAGG - Intergenic
1147667222 17:42156391-42156413 ATGAGAAGTGAAAAGGAAGAGGG + Intergenic
1149017474 17:51924886-51924908 TCCAGAAATCAAAAGGAAATTGG + Intronic
1149159199 17:53669762-53669784 CTGATAATTCAAAAGGAGGTAGG + Intergenic
1149968832 17:61195358-61195380 CTGGGAAAATAAAAGGAAATAGG - Intronic
1151166929 17:72211931-72211953 CTGAGAAATTCAAGGGCAGTTGG + Intergenic
1151544542 17:74784756-74784778 CTGAGAAATCACCCTGAAGTTGG + Intronic
1153145787 18:2030194-2030216 CTTAGAAATCAGAAGTAAATGGG + Intergenic
1153422419 18:4922357-4922379 ATGAGAAAGAAAAATGAAGTTGG - Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1155413427 18:25571007-25571029 CTTTAAAATCAAAAGCAAGTTGG - Intergenic
1155744729 18:29340107-29340129 CTGGGAATTTAAAAGGAACTAGG - Intergenic
1156525914 18:37767080-37767102 CTAAGCAGTCAAAAGGAACTAGG + Intergenic
1156913100 18:42434606-42434628 CTGAGAATTGAAAATGAAATTGG + Intergenic
1158020508 18:52836419-52836441 TTGCAAAATCAAAAGCAAGTTGG + Intronic
1158072144 18:53484728-53484750 CTGAGAAAGAAAAACAAAGTTGG - Intronic
1158822726 18:61179519-61179541 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1159177968 18:64863459-64863481 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1159300232 18:66554861-66554883 TGGAGAAATTAAAAGGAACTTGG + Intronic
1159752574 18:72320979-72321001 CTGAGAAATAAAAGAGAAGTGGG + Intergenic
1159878848 18:73839051-73839073 CTGAGAAAAAGAAAGAAAGTTGG + Intergenic
1160676267 19:392975-392997 CTGAGAAATCAACAGGATGGGGG - Intergenic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164508104 19:28875736-28875758 GTGTGAAATCGTAAGGAAGTTGG - Intergenic
1166637921 19:44468316-44468338 TTGAGAAATGAAAATGAGGTTGG - Intergenic
925281521 2:2688597-2688619 CTGAGAAACCGAGAGAAAGTAGG - Intergenic
925568304 2:5281122-5281144 CTGAGAAAGTAAAACAAAGTTGG + Intergenic
926097059 2:10088395-10088417 CTCAGAACTCAAAAGTCAGTGGG + Intergenic
926378455 2:12259711-12259733 CTGTGAAATCACCAGGGAGTTGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926764957 2:16316172-16316194 CTGAGAACTTACAAGGAAGGTGG + Intergenic
926819029 2:16832713-16832735 CTGTAAAATAAAAAGCAAGTTGG - Intergenic
926819960 2:16841140-16841162 CTAAGAACTGAGAAGGAAGTTGG - Intergenic
927787889 2:25986557-25986579 CTGAGAAATACGCAGGAAGTTGG - Intergenic
928417295 2:31106491-31106513 CTCAGAAATGAAGATGAAGTTGG - Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928878775 2:36073041-36073063 CTTAAACATCCAAAGGAAGTTGG + Intergenic
929235449 2:39600620-39600642 TGGAGAAATCAAAAGCCAGTTGG + Intergenic
929253619 2:39785732-39785754 GTAAGAAGTCAAAAGGAGGTAGG + Intergenic
930663218 2:54076217-54076239 CAGAGAAATGAAAAGGTACTGGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
930905870 2:56566737-56566759 CTGGGAAATAAAAAGGATGAGGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931377845 2:61723706-61723728 TGGAGAAATGAAAAGGAAGGAGG + Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932904312 2:75733338-75733360 CTATAAAATCAAAAGCAAGTTGG + Intergenic
933269873 2:80221745-80221767 CTGAGCAATCAAAAAGATGAAGG + Intronic
934137375 2:89009795-89009817 CTGAGAAAGAAAAAGAAATTGGG + Intergenic
934140819 2:89045802-89045824 CTGAGAAAAGAAAAAGAAATTGG + Intergenic
934228413 2:90154740-90154762 CTGAGAAAAGAAAAAGAAATTGG - Intergenic
934234861 2:90221547-90221569 CTTACAAAGCAAAAGGAATTGGG - Intergenic
934960585 2:98668986-98669008 CTGTAAAATCAAAAGCAAGCTGG - Intronic
935112515 2:100105481-100105503 GTGAGAAATAAAAAGAAAGGAGG - Intronic
935364475 2:102275064-102275086 CTGACAAAGAGAAAGGAAGTTGG - Intergenic
935936358 2:108187797-108187819 ATGATAAGTCAAAAGGAATTGGG - Intergenic
936637500 2:114275890-114275912 CTTAGAAATCAAAAGTATGGTGG - Intergenic
937612317 2:123876857-123876879 CTGATAATTAAAAAGGAATTAGG + Intergenic
937800706 2:126077503-126077525 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
938188537 2:129254571-129254593 GAGAGAAATCAAAACCAAGTCGG - Intergenic
938472422 2:131576990-131577012 CTGAGAAATAGAAACTAAGTTGG - Intergenic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
938977598 2:136494706-136494728 CTGAGAAAACAAAAGAAGCTTGG + Intergenic
939342173 2:140912069-140912091 CTAAAAAATCAATAGGAAGAGGG - Intronic
939380917 2:141435422-141435444 GAGAGCAATTAAAAGGAAGTTGG - Intronic
939632720 2:144544673-144544695 CTGAGAAAGCAAAAGTACTTGGG - Intergenic
939667195 2:144966089-144966111 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
939717759 2:145606243-145606265 CTGAAAAATGAAAAAGAAGCAGG + Intergenic
939837063 2:147142949-147142971 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
940533020 2:154904346-154904368 CTGTAAAGTCAAAAGTAAGTTGG + Intergenic
940622386 2:156128237-156128259 CTGAGATATGAAAAAGAAATTGG - Intergenic
940790682 2:158027247-158027269 CTGTAAAATCAAAAGCAAGCTGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941759892 2:169230632-169230654 CTGAGAAACGAAAGGGAACTTGG + Intronic
942314785 2:174687971-174687993 CTGAGACCTTAAAAGGAACTAGG - Intergenic
942505713 2:176639132-176639154 CTTAGAAATGAGAAGAAAGTGGG - Intergenic
942586364 2:177483525-177483547 GAGAGGATTCAAAAGGAAGTAGG + Intronic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
943491406 2:188559551-188559573 CTGTAAAATCAAAAGCAAGTGGG - Intronic
945155280 2:206831578-206831600 CTGAGAAATCTAAAGCCAGAGGG - Intergenic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
945555963 2:211276358-211276380 TTGAGATATCTAAAGGAAATTGG - Intergenic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
946732153 2:222720282-222720304 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
947447855 2:230178299-230178321 GGGAGAATTCAAAAGGAAGATGG - Intronic
947787641 2:232837966-232837988 TTGACAAATCAAAAGCAAATAGG - Intronic
1168773592 20:431261-431283 CTGAGAGGTCAAAAGGGAGCAGG - Intergenic
1169736150 20:8839689-8839711 CTGAGAAATCAAAAGCAGATAGG - Intronic
1170009829 20:11710653-11710675 CTGAGAAAGAAAAACGAAGCTGG + Intergenic
1170287218 20:14723046-14723068 CTGAGAATTAAAAGAGAAGTGGG - Intronic
1170320836 20:15096123-15096145 CTGAGAAATGAAAAGACACTAGG + Intronic
1170731823 20:18982678-18982700 CTGAGATAACTAGAGGAAGTAGG + Intergenic
1170894737 20:20403014-20403036 GTGAGAAATGACAAGGAAGGAGG - Intronic
1170897518 20:20429252-20429274 CTGAGACAGCATAAGGGAGTAGG - Intronic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1174286456 20:49477461-49477483 CTCAGAAAAAAAAAGAAAGTGGG + Intronic
1176318615 21:5281614-5281636 CTGCTGAATCAAAAGAAAGTTGG + Intergenic
1176476591 21:7220951-7220973 CTGCTGAATCAAAAGAAAGTTGG + Intergenic
1177040626 21:16105451-16105473 TTGAGAAATAAAAACAAAGTTGG - Intergenic
1177881592 21:26701839-26701861 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1178026522 21:28474601-28474623 CTGAGATACCAAAAGGAATGGGG - Intergenic
1178365939 21:31988841-31988863 CCGAGAAAGAAAAAGGAAGGAGG - Intronic
1178399380 21:32271762-32271784 ATGAGAAATAAAAAGCATGTCGG + Intronic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1180396383 22:12347698-12347720 CTGCCAAATCAAAAGAAAGTTGG + Intergenic
1180403330 22:12516392-12516414 CTGCCAAATCAAAAGAAAGTTGG - Intergenic
1180470840 22:15653614-15653636 CTGAGAAATAGAAACTAAGTTGG - Intergenic
1180472879 22:15676604-15676626 CTGAGAAATAGAAACTAAGTTGG - Intergenic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181186136 22:21105592-21105614 CTGAGAAATACAAACTAAGTTGG - Intergenic
1181370898 22:22415905-22415927 CTGATCAATCTAAAGGAAGAGGG + Intergenic
1182182450 22:28363904-28363926 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1183198843 22:36372115-36372137 TAGAGAAAGCAACAGGAAGTGGG - Intronic
949524520 3:4890041-4890063 GTGAAACATCAAAAGGAATTAGG + Intergenic
950900941 3:16496934-16496956 CTCAAAAATCAAAAAGGAGTGGG + Intronic
951850874 3:27138518-27138540 AAGAGAAATCTAAAGGATGTAGG - Intronic
952067325 3:29586560-29586582 CTTAGTAATCAAATGGAACTAGG + Intronic
952411612 3:33054608-33054630 TTAAGAAATCAAAGGGATGTGGG + Intronic
953381207 3:42474070-42474092 CAGAGAGATCATAAGAAAGTGGG + Intergenic
953961915 3:47273111-47273133 CTGAAAGATCAAAAGCAAGAAGG - Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
955596332 3:60594659-60594681 GTGAAGACTCAAAAGGAAGTAGG - Intronic
955756469 3:62229641-62229663 CTGAGAAATCCAAAGAAAGATGG - Intronic
956546281 3:70407399-70407421 CTGTGAAATTAAAAGCAAGCTGG + Intergenic
957374395 3:79337087-79337109 CTGTAAAATCAAAAGCAAGCTGG - Intronic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
958094096 3:88919178-88919200 CTGAGAACTGAACAGGAAGGGGG + Intergenic
958132447 3:89445646-89445668 GTGGGAAAGCATAAGGAAGTGGG - Intronic
958160761 3:89814847-89814869 CTCTAAAATCAAAAGCAAGTAGG + Intergenic
958614175 3:96469431-96469453 CAGAAAAATCAAAATGAAGGTGG - Intergenic
958802160 3:98768726-98768748 CTGGGAAGTCAATAGAAAGTAGG - Intronic
959492301 3:107005047-107005069 GTGAGAAATTAAATAGAAGTTGG + Intergenic
959570922 3:107882788-107882810 CTGAGACACAGAAAGGAAGTCGG + Intergenic
960533727 3:118793941-118793963 CTGAGAAATCCAAATGAAAACGG + Intergenic
960564314 3:119117756-119117778 CTGTAAAATCAAAGGCAAGTTGG + Intronic
960795957 3:121488065-121488087 CTGAAAAATCAAAATTAACTGGG - Exonic
961719300 3:128882010-128882032 CTGAAAAAGCAAAAGGAATCTGG - Intronic
961970188 3:130955585-130955607 CTGAGAAATCCAGAGGATTTGGG - Intronic
962261493 3:133911609-133911631 TTGAAAAACCAAAAGAAAGTAGG - Intergenic
964508633 3:157425643-157425665 CTGTAAAATCAAAAGCAAGTTGG - Intronic
964707473 3:159634806-159634828 ATAAGAAATCAAAAGGAAAAGGG - Intronic
965088048 3:164124960-164124982 CTGAGAAAGCATAATGAAGTTGG + Intergenic
965339041 3:167463349-167463371 CTGGGAAATGAAAGAGAAGTTGG + Intronic
965376807 3:167934979-167935001 CTGAGAATTCATAATGAATTGGG + Intergenic
965580035 3:170258056-170258078 CAGAGAAGATAAAAGGAAGTAGG + Intronic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
966452496 3:180078059-180078081 CTGTAAAATCAAAAACAAGTTGG + Intergenic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
969104215 4:4792838-4792860 CTAAGAAAGAAAAAGAAAGTAGG - Intergenic
969121833 4:4916588-4916610 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
969130704 4:4989291-4989313 CTGAGACAGCAAAAGAAAGAAGG - Intergenic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
969993808 4:11291359-11291381 ATGAGAATGCAAAAGGAAGGGGG - Intergenic
970061615 4:12039980-12040002 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970239094 4:13989416-13989438 CTGAGAAACCTCTAGGAAGTAGG - Intergenic
970483099 4:16497539-16497561 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970547136 4:17141164-17141186 CTGAGAAAAAAAAAATAAGTGGG + Intergenic
970721746 4:18996761-18996783 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
971277820 4:25214979-25215001 CAGTAAAATCAAAAGCAAGTTGG + Intronic
971524053 4:27593375-27593397 CTGAGAAATGAAGAGGATATAGG - Intergenic
971681406 4:29706129-29706151 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
972048529 4:34699285-34699307 CTGACAACATAAAAGGAAGTAGG - Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972950731 4:44319115-44319137 CTAAGAAATTCAAAGGCAGTTGG + Intronic
973144518 4:46807964-46807986 CTGAGAAAGAAAAACAAAGTTGG - Intronic
973981510 4:56312099-56312121 CTGAGAAGATAAAAGGAAGAGGG - Intronic
974314098 4:60255311-60255333 CTGAGAAAATAGAAGGTAGTTGG - Intergenic
975057647 4:69954723-69954745 CTAACAAATCAAAATGAACTGGG - Intergenic
975329059 4:73093252-73093274 CTAAGAAATCATAAGAATGTAGG - Intronic
975423482 4:74197357-74197379 CTCATATAACAAAAGGAAGTAGG + Intronic
975890143 4:79017778-79017800 CAAAGGAATCAAAAGGAAGTTGG - Intergenic
976053887 4:81040099-81040121 CTGAGAATTGAAAAGGAGGTTGG - Intronic
976101877 4:81573105-81573127 CTGAAGAGTTAAAAGGAAGTAGG + Intronic
976327479 4:83788461-83788483 ATGAGAACTCAAAAGAAAGAGGG - Intergenic
976823454 4:89233426-89233448 CTGACAAGTCAAAGGGAAGGAGG + Intergenic
977718532 4:100211292-100211314 GAGAGAAATCAAAAGTAATTTGG - Intergenic
977743139 4:100511654-100511676 CTTTGAAATGAAAAGGAAGAAGG + Intronic
977855989 4:101893896-101893918 GTGAGAGATAAAAAAGAAGTGGG - Intronic
977952747 4:102993241-102993263 CTATAAAATCGAAAGGAAGTTGG + Intronic
978161910 4:105558855-105558877 ATGAGACATCAAGAGGAAGAAGG + Intronic
979003229 4:115254377-115254399 CAGATAAATCAAAATGAAATTGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980308965 4:131101632-131101654 CTGTAAAATTAAAAGCAAGTTGG - Intergenic
980825950 4:138073347-138073369 CTGATAAATGAAAAAGAAGGTGG + Intergenic
981212530 4:142124832-142124854 CTGAAAAATTAAAAATAAGTTGG - Intronic
981414630 4:144477630-144477652 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
981611350 4:146597128-146597150 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
981684049 4:147433361-147433383 CTAAGAAATAAAAACAAAGTTGG - Intergenic
982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG + Intergenic
982471848 4:155801800-155801822 CTGATAAAACCAGAGGAAGTTGG - Intronic
982489406 4:156010504-156010526 AAGAGAAAACAAAAGGAAATTGG + Intergenic
982904203 4:161048051-161048073 CTGTAAAATTAAAAGCAAGTAGG + Intergenic
983669991 4:170225876-170225898 GTGAGAAAGAAAAAGGTAGTTGG + Intergenic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
984079038 4:175219840-175219862 CTGAGAAAGAAAAAGAAAGCTGG - Intergenic
984123320 4:175772848-175772870 TTTAGAAATCAAATGGAAGCAGG + Intronic
984318651 4:178161995-178162017 CTGAGAAGACAAGAAGAAGTGGG - Intergenic
984861179 4:184240864-184240886 CTAACAAATCAAAAGAAAGCCGG - Intergenic
985220411 4:187697601-187697623 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
985375053 4:189326387-189326409 CTGAGAAATAAAAACAAAGTTGG - Intergenic
985748023 5:1658347-1658369 CTCTGAAATGAAAAGGAAATGGG - Intergenic
987011370 5:13769455-13769477 CTGAGAATTCAAAAGGAATGTGG + Intronic
988079274 5:26395716-26395738 CTGAGAAATAAAAAGACAGAAGG - Intergenic
988105034 5:26733810-26733832 GTGAAACATTAAAAGGAAGTAGG - Intergenic
988485957 5:31668291-31668313 CAGAGAAAGCCAATGGAAGTTGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989652557 5:43709343-43709365 GAGAGAAGTGAAAAGGAAGTGGG + Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990397532 5:55398346-55398368 CTGAGAAAGCAAAGATAAGTAGG + Intronic
990438998 5:55824916-55824938 CTGACAAAGAAAAGGGAAGTTGG + Intergenic
990650308 5:57891396-57891418 CAGAAAAATAAAAAGCAAGTAGG + Intergenic
990658219 5:57982028-57982050 GTTAGAAATAAACAGGAAGTTGG - Intergenic
990682148 5:58256849-58256871 CTCAGCAATCAAAAGGAAAAAGG + Intergenic
990811603 5:59731278-59731300 AAGAGAAATGGAAAGGAAGTAGG - Intronic
991536016 5:67669860-67669882 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
992013675 5:72555735-72555757 CTGAGAAAGCTAATGGAAGATGG - Intergenic
992209182 5:74460910-74460932 CTCAAAAACCAAAAGGAAGTTGG + Intergenic
992860885 5:80908377-80908399 ATGACTAATCAAAAGGAAGCTGG + Intergenic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993263007 5:85684834-85684856 CTGCAAAATCAACAAGAAGTTGG + Intergenic
993967087 5:94371896-94371918 CTGTAAAATCAAAAGCAAGTTGG + Intronic
995137865 5:108700109-108700131 CTCAGAAATTAAAAAGAAGGAGG + Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
996071578 5:119137320-119137342 CTGTAAAATCAAAAGCAAGTTGG - Intronic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996319528 5:122199002-122199024 TTAAGAAATCAAAAGAAAGTTGG - Intergenic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
997106620 5:131027773-131027795 CTGAAAATTCAACAAGAAGTTGG - Intergenic
997508441 5:134436742-134436764 CTGAGAGCACAAAATGAAGTTGG + Intergenic
997897545 5:137733340-137733362 CTGATAACTAAAAAGAAAGTTGG - Intronic
998725933 5:145014873-145014895 CTGAGAAGTCAAGAGGCAATTGG - Intergenic
998895454 5:146794537-146794559 GTCAGAACTAAAAAGGAAGTGGG - Intronic
999104326 5:149056694-149056716 CTGAGAAACAATAAGGAAGCTGG + Intronic
999908203 5:156166998-156167020 AGGAGAAATCAGAAGGAAGTAGG - Intronic
1000107162 5:158071022-158071044 CTGAGAAATGAAGAGAAAGCAGG - Intergenic
1000307813 5:160011718-160011740 TTGTGCAATCAGAAGGAAGTAGG - Intronic
1000383511 5:160650563-160650585 CTGACAAATCATAAGGATTTGGG - Intronic
1002379431 5:178815514-178815536 CTGAGAAATACAAACTAAGTTGG + Intergenic
1002695874 5:181088109-181088131 CTGAAAAATAAAAATGAAGAGGG + Intergenic
1003238479 6:4319907-4319929 CTGACAATTCAAAAGAAATTTGG + Intergenic
1004333107 6:14739612-14739634 CTGAGAAAACAACAGGCACTTGG + Intergenic
1004718584 6:18243795-18243817 CTCAGAAATCAAAAGCCAGTGGG + Intronic
1004866140 6:19855090-19855112 CTGAAAAATCTATAGGGAGTCGG - Intergenic
1005073332 6:21882956-21882978 CTTAGAAATCAAAAAGAAATGGG + Intergenic
1005127991 6:22470774-22470796 CTGATAAAGCTAAAGGAAGCGGG - Intergenic
1005529934 6:26692940-26692962 CTGAGAAATGAAGATGAAGATGG - Intergenic
1005540862 6:26808707-26808729 CTGAGAAATGAAGATGAAGATGG + Intergenic
1005611580 6:27530281-27530303 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1006342044 6:33452405-33452427 CTGAGAAATCAAGGGGTAATAGG - Exonic
1007513169 6:42390507-42390529 GTGAGGAAGCAACAGGAAGTGGG - Intronic
1008153941 6:47990198-47990220 CTGAAAAATCAAAAGCAAGCTGG - Intronic
1008224496 6:48897467-48897489 CAGAGTAATCAAAAGACAGTTGG - Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1008756222 6:54797854-54797876 CTGTAAAATCAAAAGCAAGCTGG - Intergenic
1008866718 6:56220871-56220893 CTGAGATATTTAAAGGAAGCTGG + Intronic
1009011674 6:57850796-57850818 CTGAGAAATGAAGATGAAGATGG + Intergenic
1009865134 6:69387914-69387936 ATGAAAAATAAAAAGGAAATTGG + Intronic
1009896505 6:69757258-69757280 CTGAGAAGTCAAAAAAAAATGGG + Intronic
1010006951 6:71006054-71006076 CTGAGAAAGAAAAATAAAGTTGG - Intergenic
1010842876 6:80669393-80669415 CTGAGAAATAAAGAGGATATGGG - Intergenic
1010853682 6:80810912-80810934 TTAATAAAACAAAAGGAAGTAGG - Intergenic
1011681161 6:89784489-89784511 GTGAGACATAAAAGGGAAGTGGG + Intronic
1011720581 6:90151762-90151784 CTGAAAAGCCATAAGGAAGTTGG - Intronic
1012005976 6:93713793-93713815 CTCAGAAACAAAAAGGATGTTGG - Intergenic
1012136021 6:95556998-95557020 CAGATTAATAAAAAGGAAGTGGG - Intergenic
1012281183 6:97329462-97329484 TTGTAAAATCAAAAGTAAGTCGG - Intergenic
1012363197 6:98408471-98408493 CTGGGAAAACTAAAGGCAGTGGG - Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013657885 6:112264375-112264397 CTGAGTAATAGAAAGGAAGAAGG + Intergenic
1013688172 6:112609854-112609876 CTGTTAAATCAAAAGCAAGTTGG - Intergenic
1014033347 6:116736012-116736034 ATCACAAATCAAAAGTAAGTTGG + Intronic
1014125751 6:117775089-117775111 CTTTGAAATGAAAAAGAAGTGGG + Intergenic
1014499425 6:122166645-122166667 CAGATAAATCAAAAGAAAGATGG + Intergenic
1014524238 6:122482310-122482332 CTGAGAAAGGAAAAAGGAGTTGG + Intronic
1014861324 6:126470930-126470952 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1016444001 6:144114048-144114070 CTGAGAAATTTAAAGGATATAGG - Intergenic
1016738379 6:147505406-147505428 CTGAGAGGTCAAAAGTGAGTAGG + Intergenic
1016967167 6:149729630-149729652 CTGGGAAAACAAAAGGTAATAGG - Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1018528398 6:164737501-164737523 ATGAAAAACCAAAGGGAAGTTGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019745544 7:2698535-2698557 CTAAAAAAACAAAAAGAAGTTGG + Intronic
1021205923 7:17780971-17780993 TTGAAAAATCAAAACCAAGTTGG + Intergenic
1021815490 7:24443448-24443470 CTGAGAGAGAAAAAGGAATTTGG - Intergenic
1022163215 7:27732599-27732621 CTGAGAACTGAAAAGTAGGTTGG + Intergenic
1022170699 7:27826590-27826612 CTGAGAGATAAAAAGGAAATAGG + Intronic
1022862606 7:34383449-34383471 CTATAAAATCAAAAGCAAGTTGG - Intergenic
1023477776 7:40599636-40599658 CTTAGAAATCAAAAGCAATTGGG - Intronic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023893398 7:44411112-44411134 CTAATAATTCAAAATGAAGTTGG + Intronic
1024503216 7:50135877-50135899 ATGAGAAAACAAATGGAAATTGG + Intronic
1026500050 7:70936399-70936421 CTGAGAGATGAGAATGAAGTGGG + Intergenic
1027785466 7:82574237-82574259 CTGTAAAATCAAAAGCAAATTGG + Intergenic
1028789707 7:94840119-94840141 CTGAGAAATTAAACAAAAGTTGG - Intergenic
1030381266 7:108814058-108814080 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1030414848 7:109230218-109230240 CTGAGATCTCACCAGGAAGTTGG + Intergenic
1031121932 7:117731726-117731748 CTGATAACAAAAAAGGAAGTCGG + Intronic
1031261302 7:119524510-119524532 CTGAGAAATACACATGAAGTAGG + Intergenic
1031408397 7:121412682-121412704 CTCAGAAATCAAAATGGAGAGGG + Intergenic
1031773456 7:125876088-125876110 CTGAGAAAGTAAAATGAAATTGG - Intergenic
1032616642 7:133479762-133479784 GTCTGAAAGCAAAAGGAAGTTGG + Intronic
1033313679 7:140280791-140280813 CTGAGACATCAAGAGGAATGAGG + Intergenic
1033523365 7:142184793-142184815 CTGAGAAATCACTCGAAAGTTGG + Intronic
1033837662 7:145335300-145335322 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1033871847 7:145763219-145763241 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1034092702 7:148378843-148378865 CTGAGAAATTGAAAGGGAATCGG + Intronic
1035466461 7:159082679-159082701 CTTAGAAACCCAAAGGAAATGGG - Intronic
1036106396 8:5845573-5845595 CTGCAAAATCAAAAGCAAGTTGG + Intergenic
1036199683 8:6758327-6758349 CTGTGAAATCAAAGAGAAGCAGG - Exonic
1036809667 8:11858882-11858904 TTAAGAAATAAAAGGGAAGTGGG - Intronic
1037297900 8:17420625-17420647 CTCAAACATCAGAAGGAAGTGGG + Intergenic
1037307945 8:17525442-17525464 TTGAGAAATAAAAAGAAAATGGG - Intronic
1037650001 8:20827555-20827577 CTGACAAATGAAAAGGTAATTGG + Intergenic
1038177749 8:25196467-25196489 CTGAGAAATCACAAGTAATTTGG + Intronic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1039337662 8:36610582-36610604 TTTACAGATCAAAAGGAAGTAGG + Intergenic
1039656013 8:39408195-39408217 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1040130351 8:43788585-43788607 CTGCTGAATCAAAAGAAAGTTGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1042472611 8:69208714-69208736 CTGAGAAATCTGAAGGGAGCTGG - Intergenic
1042498386 8:69481867-69481889 CTGAGATATAAATAGGAAATAGG - Intronic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045323671 8:101101068-101101090 CTGAGAAATTAAAGGGATGGTGG - Intergenic
1045856960 8:106775604-106775626 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1046264480 8:111813721-111813743 TTGTAAAATCAAAAGCAAGTTGG + Intergenic
1046445170 8:114309773-114309795 CTGAGAAATCACAGGTAAATGGG - Intergenic
1046703140 8:117423527-117423549 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1046908041 8:119595449-119595471 ATTAGAACTCAATAGGAAGTTGG - Intronic
1047447724 8:124934410-124934432 TGGGGAAACCAAAAGGAAGTAGG + Intergenic
1047634719 8:126748396-126748418 AAGAGACATGAAAAGGAAGTTGG + Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048152345 8:131905774-131905796 CTGAGAAACCAAAGGGGAGGAGG + Intronic
1048537619 8:135312312-135312334 CTGTAAAATTAAAAGCAAGTTGG + Intergenic
1048806637 8:138247083-138247105 CTGCAAAATCAAAAGCAAGTTGG - Intronic
1049785544 8:144448995-144449017 CTGAGAAATGGAGAGGAACTGGG - Intergenic
1050796093 9:9544391-9544413 CTAAAAAATCAAAATGAAGTCGG - Intronic
1050956100 9:11662337-11662359 CTGAGAAATAAAAACAAAGTTGG - Intergenic
1051895691 9:21985908-21985930 CTGAAAAATTATAATGAAGTAGG + Intronic
1051990296 9:23144981-23145003 CTGTAAAATCAAAAACAAGTTGG + Intergenic
1052254409 9:26437420-26437442 CTTGGAACTCAAAGGGAAGTTGG - Intergenic
1052767869 9:32660086-32660108 CTGTGAAATCAAAAGCAGGTTGG + Intergenic
1053318651 9:37075634-37075656 CTGGAAAATAAAAAGGAAGGAGG + Intergenic
1053652157 9:40179606-40179628 CAGAGACTTAAAAAGGAAGTAGG - Intergenic
1053668128 9:40331522-40331544 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1053902551 9:42808920-42808942 CAGAGACTTAAAAAGGAAGTAGG - Intergenic
1054379272 9:64471578-64471600 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1054516483 9:66044771-66044793 CAGAGAAAGCAAAGGGAAATTGG - Intergenic
1054532427 9:66196600-66196622 CAGAGACTTAAAAAGGAAGTAGG + Intergenic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1055153159 9:73027668-73027690 CAGAAAAACCAAATGGAAGTAGG - Intronic
1055168972 9:73231340-73231362 ATGACAAATAGAAAGGAAGTAGG + Intergenic
1055323304 9:75102985-75103007 CTGATAAATCAAACACAAGTAGG + Intronic
1055575922 9:77660192-77660214 CTTAGAAATGGAAAGGAATTGGG + Intergenic
1055838151 9:80469768-80469790 CTAAGAAAGCAAAACAAAGTTGG + Intergenic
1056376585 9:86019584-86019606 CTGAGATATCAAAATAAACTTGG + Intronic
1057158073 9:92862005-92862027 CACAGATGTCAAAAGGAAGTGGG + Intronic
1057634587 9:96752031-96752053 CTTATAAATAAAAAGGAAGTTGG - Intergenic
1058152913 9:101481614-101481636 CTGAGAAATGAACATGAACTAGG + Intronic
1058257180 9:102781374-102781396 TTGAGAAAAAAAAAGGTAGTTGG - Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059285219 9:113166530-113166552 CTGAGAGAGCGAGAGGAAGTGGG + Intronic
1059708329 9:116844214-116844236 GTGGGACATCAAAAGGAAGAAGG - Intronic
1059816855 9:117926363-117926385 ATGAGAAAAGAAAAGGAATTTGG + Intergenic
1060079304 9:120626962-120626984 CTGAGAATTCTAAGGAAAGTAGG + Intronic
1060220986 9:121764004-121764026 CTGAGAGCTCAAAAGGGACTAGG - Intronic
1061633914 9:131893329-131893351 CTGTGCAGTCAAAAGGAATTAGG + Intronic
1062292690 9:135804162-135804184 CTGAGAATTCAGAAGCAAATGGG - Intergenic
1062355693 9:136160942-136160964 CTGACAAATCCAAAGGAAGATGG - Intergenic
1203412025 Un_KI270579v1:23637-23659 CTGCTGAATCAAAAGAAAGTTGG + Intergenic
1203415109 Un_KI270584v1:2654-2676 CTGCTGAATCAAAAGAAAGTTGG + Intergenic
1185927440 X:4162907-4162929 CTCAGATATCAAAAGGCAGAGGG + Intergenic
1186759399 X:12708016-12708038 GTGAGAATTCTAAAGAAAGTTGG - Intronic
1187365977 X:18666242-18666264 TGGAGAAAACACAAGGAAGTAGG + Intronic
1187744758 X:22396821-22396843 CTGAGAAAATAAAAGGTACTCGG + Intergenic
1187754407 X:22505452-22505474 CTGATAAACCAAAAGAAAATCGG - Intergenic
1187961000 X:24565886-24565908 CTTATAAATCAAAAAGAAGAAGG + Intronic
1189548038 X:42063309-42063331 CTAAAAAATCAAGAGGAAATGGG - Intergenic
1189555680 X:42142828-42142850 ATGAGAAATCAAGAAGAAGCGGG + Intergenic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1190854729 X:54282637-54282659 CTGAGAAAGGAAAACTAAGTTGG + Intronic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1191722567 X:64246582-64246604 CTAAGAAAACAGAAAGAAGTAGG - Intergenic
1193236539 X:79114030-79114052 CTGTAAAATCAAAAGCAAGCTGG + Intergenic
1193271907 X:79538234-79538256 CTGGGAAATCAAAATCAAGTAGG - Intergenic
1193285942 X:79714611-79714633 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1193390168 X:80917004-80917026 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
1193543130 X:82795480-82795502 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1193645270 X:84060665-84060687 TTGAGAAGTAGAAAGGAAGTAGG + Intronic
1194860256 X:98990731-98990753 CTGTGAAATCAAAACCAAATTGG + Intergenic
1195052024 X:101105734-101105756 CTGAGATATCAAAAGGAGGCTGG - Intronic
1195425394 X:104723644-104723666 CAGAGAAATGACAAGGAATTTGG + Intronic
1195813595 X:108860546-108860568 CTGAGGAATAAAAAGGTAGTTGG - Intergenic
1195965506 X:110426729-110426751 CTTAGAAAGGAAAAGGAAGACGG - Intronic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1196664742 X:118304613-118304635 CCGTAAAATCAAAAGCAAGTTGG + Intergenic
1197356078 X:125438647-125438669 CTGTCACATCAAAAGGAAGGAGG - Intergenic
1197630123 X:128848758-128848780 CTGAGAAAGCAAAGGGGACTGGG - Intergenic
1198059251 X:133027768-133027790 TTGAGATAGCAAAAGGAAGTGGG - Exonic
1198092873 X:133349265-133349287 CGGAGAAAGCAAAAGGAAGAAGG + Intronic
1198960990 X:142182993-142183015 CTGAGAAATGTACAGGATGTGGG + Intergenic
1199306103 X:146269202-146269224 CTCAGAAGACAAAAGGATGTGGG + Intergenic
1201784037 Y:17753969-17753991 TTGAGAAAGAAAAAAGAAGTAGG - Intergenic
1201817516 Y:18152018-18152040 TTGAGAAAGAAAAAAGAAGTAGG + Intergenic