ID: 954576650

View in Genome Browser
Species Human (GRCh38)
Location 3:51680075-51680097
Sequence CAGAGCTACCCAAGTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954576650_954576663 25 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576663 3:51680123-51680145 TAAGGGCAGCCCTCTGTGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 192
954576650_954576659 -4 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576659 3:51680094-51680116 TCTGGGTCAGTGGGCTGGCATGG 0: 1
1: 0
2: 2
3: 57
4: 325
954576650_954576661 7 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576661 3:51680105-51680127 GGGCTGGCATGGGAAGAGTAAGG 0: 1
1: 0
2: 3
3: 51
4: 449
954576650_954576660 -3 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576660 3:51680095-51680117 CTGGGTCAGTGGGCTGGCATGGG 0: 1
1: 0
2: 0
3: 65
4: 944
954576650_954576658 -9 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576658 3:51680089-51680111 GTAGCTCTGGGTCAGTGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 236
954576650_954576664 26 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576664 3:51680124-51680146 AAGGGCAGCCCTCTGTGCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 246
954576650_954576662 8 Left 954576650 3:51680075-51680097 CCCCCTTAACTTGGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 954576662 3:51680106-51680128 GGCTGGCATGGGAAGAGTAAGGG 0: 1
1: 0
2: 2
3: 26
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954576650 Original CRISPR CAGAGCTACCCAAGTTAAGG GGG (reversed) Intronic
900431242 1:2604138-2604160 CACAGCTGGCCAAGGTAAGGGGG - Exonic
901438958 1:9265969-9265991 CAGAGATCCCCAATTTAAGAGGG + Exonic
902178426 1:14669165-14669187 CAGGGCTTCCCAAGTTGGGGTGG - Intronic
910815331 1:91286592-91286614 CAGATATAATCAAGTTAAGGTGG - Intronic
911698666 1:100925084-100925106 CAGATCTACTCAATTTAAAGTGG - Intronic
914922760 1:151858862-151858884 CAGGGCCACCCAAGACAAGGAGG - Intergenic
917236786 1:172901296-172901318 CAGACCTGCCCAACTGAAGGAGG - Intergenic
920891620 1:209992804-209992826 AAGATCTGCCCAAATTAAGGTGG - Intronic
921266711 1:213426464-213426486 CTGAGCTACTCTAGTTACGGGGG - Intergenic
922351192 1:224735764-224735786 CCCAGCTACTCAGGTTAAGGTGG - Intronic
924355184 1:243165784-243165806 CAGAGCTGCCTAAGTGAAGTAGG + Exonic
1064927524 10:20585501-20585523 CAGAGCTGTCCTAGTTGAGGAGG + Intergenic
1065679253 10:28212287-28212309 GAGAACTACACAAGTTCAGGTGG + Intronic
1069922425 10:71824313-71824335 CAGGGCTGCCCAAGTAAGGGGGG + Intronic
1071168943 10:82840980-82841002 CAGATGTAACCAAGTTAAGGTGG + Intronic
1073004432 10:100311894-100311916 CAGAGCTATCCAGGTTAGGAAGG - Intronic
1079011494 11:16832260-16832282 TAGAACAACCCAATTTAAGGTGG - Intronic
1080511523 11:32978498-32978520 AAGAGCTACCTAAATTAAGGTGG - Exonic
1089136729 11:116255167-116255189 CAGAGATAATCAAGTTAAAGTGG - Intergenic
1093984754 12:25517989-25518011 CAGATCTACCCAAGGTGAGGAGG - Intronic
1094240348 12:28215029-28215051 GAGGGCTACCCATATTAAGGAGG - Intronic
1094337263 12:29373891-29373913 CAGAGCTAAACAAGTTTAGCGGG - Intronic
1101772708 12:107766336-107766358 CAGAGGTAGCCAAGATAAGGGGG - Intergenic
1102585789 12:113922044-113922066 CAGAGCCACCCAAAGCAAGGAGG - Intronic
1107161469 13:37233788-37233810 CATTGATACCCAAGTGAAGGGGG + Intergenic
1108242536 13:48481089-48481111 CAAACCTTCCCAAATTAAGGAGG - Exonic
1108487672 13:50943562-50943584 CAGAGATACAGAAGTTAGGGAGG - Intronic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG + Intergenic
1112072675 13:95871886-95871908 CAGAGCCAGCAAAGTTACGGTGG + Intronic
1112556013 13:100469283-100469305 CAGAGCTACCCAGGCAAAGCAGG + Intronic
1113673669 13:112194065-112194087 CAGACCTACAAAAGTTAAGCAGG + Intergenic
1121225420 14:92318445-92318467 AAGAGTTATCCAGGTTAAGGGGG + Intergenic
1123959836 15:25385841-25385863 CAGAGTTACCCAATTATAGGGGG + Intronic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1124911919 15:33929498-33929520 GTGAGCTACCCAAGTAAAAGAGG + Intronic
1130139939 15:81216489-81216511 AAGAGCTACCCAAATTATGGTGG + Intronic
1137575918 16:49600364-49600386 CAGATCCTCCCAAGTTATGGAGG + Intronic
1148344352 17:46893609-46893631 TGTAGCTACCCAAGTCAAGGGGG - Intergenic
1150747016 17:67824952-67824974 CAGAGTTTCCTAAGTTCAGGGGG + Intergenic
1155249587 18:23941893-23941915 GAGGGGTAGCCAAGTTAAGGAGG - Intronic
1156109614 18:33709804-33709826 CAGAGCCAAACAAGTTAGGGCGG - Intronic
1160409060 18:78662687-78662709 CAGAGCTACCCAAGCTATAGAGG + Intergenic
1162110448 19:8397108-8397130 CAAAGTTAACCAAGATAAGGAGG + Intronic
1162744041 19:12789424-12789446 CAGAGCTACTCTAGGGAAGGAGG + Intronic
1166153568 19:40893177-40893199 GAGATCTACCTAAGTGAAGGAGG - Intronic
1168040000 19:53750726-53750748 CAGAGATACACAAGTACAGGTGG - Intergenic
925619394 2:5776283-5776305 CATTGCTACCCAAAATAAGGTGG - Intergenic
929785153 2:44984325-44984347 CAGAGCTCCCCAAGTGAGCGAGG + Intergenic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
932334420 2:70921795-70921817 CAGTCCTACCCAGGTGAAGGGGG - Intronic
933412372 2:81942094-81942116 CAGACCTACCCAAATTCAAGAGG - Intergenic
935555860 2:104508815-104508837 CAGAGCTCCCCAAGGTCAGCTGG - Intergenic
938570526 2:132558174-132558196 CAGAGCTAGAGAAGCTAAGGAGG - Intronic
939334738 2:140811088-140811110 CAGAGCTACTCAAATTACAGTGG + Intronic
939671575 2:145018942-145018964 CAAAGCTTCCCAAGTGAGGGTGG + Intergenic
941408031 2:165116553-165116575 CTCAGCTACCAAAGTTAATGGGG - Intronic
943587935 2:189762562-189762584 CAGCGCTACCCAAGTCACGTGGG - Intronic
946045605 2:216818447-216818469 CAGAGCAACCCAGGCTAAGGTGG + Intergenic
1169635727 20:7689469-7689491 CAGGGCTACCCAAGTTTTTGGGG + Intergenic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1179617502 21:42591355-42591377 CAGGCCCACCCAAGTTATGGAGG - Intergenic
1183484794 22:38082974-38082996 CAGGGCTACCCACGTGAGGGTGG + Intronic
949195007 3:1294699-1294721 TAGAGCTATCCAAGTGACGGAGG - Intronic
949934949 3:9109424-9109446 CAGAGCGAGCCAAGGCAAGGAGG + Intronic
954576650 3:51680075-51680097 CAGAGCTACCCAAGTTAAGGGGG - Intronic
955892935 3:63669360-63669382 CAGAGCTACCCAGCTTGTGGTGG - Intronic
955947083 3:64205806-64205828 CAGGGCTGCCCAAGTTGATGTGG + Intronic
956203901 3:66736574-66736596 CAGAGCAGCTAAAGTTAAGGGGG - Intergenic
957132023 3:76235174-76235196 CATAGGTAACCAAGTTAAGATGG + Intronic
960021878 3:112964403-112964425 CAGAGCTACCCAAGACCATGGGG + Intronic
962866966 3:139455017-139455039 CAGAGCAAGCCAAGATAAGCTGG - Intronic
971151588 4:24038400-24038422 AAGGGGTACCCAAGTTATGGAGG - Intergenic
972880515 4:43417120-43417142 CAGAGCTACCCAAGACCACGGGG - Intergenic
979246613 4:118513847-118513869 CAGAGCTGCCTAAGTGAAGTAGG - Intergenic
983442456 4:167803834-167803856 CAGAGTTAACCAGGTAAAGGAGG + Intergenic
983851238 4:172583225-172583247 AAGAAGTACCCAAGTTAAAGTGG + Intronic
985425474 4:189826081-189826103 CAAAGTAAACCAAGTTAAGGTGG + Intergenic
986423863 5:7611087-7611109 CAGAGCTTCCCATGGTCAGGTGG - Intronic
988818513 5:34857958-34857980 CAGAGCTACCCAATCTTTGGAGG - Intronic
990859055 5:60304946-60304968 CAAAGATACCCAAGTTGAGTGGG - Intronic
993090615 5:83421637-83421659 CAATGCGACCCAAGTGAAGGGGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1001159735 5:169302031-169302053 CAGACCTAGCCAATTTAAAGCGG - Intergenic
1004805661 6:19201458-19201480 CAGAGCTGCCCAAGATCATGAGG - Intergenic
1006983281 6:38162332-38162354 CAGAGCTGACCAAGTGGAGGAGG - Intergenic
1015473374 6:133632040-133632062 GAGAGCTTGCAAAGTTAAGGAGG + Intergenic
1018351315 6:162962158-162962180 AAGAGTTTCCCAAGGTAAGGTGG - Intronic
1022086024 7:27068433-27068455 CAGTGTTACCCAAGTTAATGAGG + Intergenic
1028690978 7:93650284-93650306 CACATCTAGCCAAGTTAAGAAGG + Intronic
1034844220 7:154429691-154429713 AATGGCTACCCAAGTCAAGGAGG + Intronic
1035153445 7:156893382-156893404 AGGGGCTACCCCAGTTAAGGAGG + Intergenic
1038220167 8:25599741-25599763 CACAGCTCCCCAAGGTGAGGAGG - Intergenic
1038894615 8:31768397-31768419 CACAGCAACTCAAGATAAGGTGG - Intronic
1042448409 8:68916666-68916688 CTGAGCTATCCAAGATAAGGTGG - Intergenic
1043056053 8:75440968-75440990 CCCAGCTACTCAGGTTAAGGTGG - Intronic
1046997417 8:120539772-120539794 TATAGCTACCAAAGTTAAGGTGG + Intronic
1055082266 9:72279138-72279160 CAGAGCTACGAAAGTGAAAGGGG - Intergenic
1056449723 9:86705179-86705201 CAGAGCTAAGAAAGGTAAGGCGG - Intergenic
1059403906 9:114088084-114088106 CAGAGCCACCCAAGCTAACGTGG + Intronic
1060973060 9:127749734-127749756 CAGAGCAACCCAGGATTAGGGGG + Intronic
1061079356 9:128360928-128360950 CAGAGCTGCCCAAGTTCACTGGG + Exonic
1062157824 9:135063542-135063564 CAGAGCTGCCCAAGACCAGGGGG - Intergenic
1062252825 9:135606794-135606816 CAGAGCTACCCAGGTGGGGGTGG - Intergenic
1193142877 X:78047195-78047217 TCGAGCTAACCAAGTTTAGGTGG + Exonic
1197505053 X:127291432-127291454 CAGAGATAACCAAGCTAATGAGG + Intergenic
1198775338 X:140173111-140173133 CAGAGCTGCCCAAGGCCAGGGGG + Intergenic