ID: 954578934

View in Genome Browser
Species Human (GRCh38)
Location 3:51692594-51692616
Sequence CTGCTCGTACAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954578934_954578937 -8 Left 954578934 3:51692594-51692616 CCCAGCTCCATCTGTACGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 177
954578934_954578941 30 Left 954578934 3:51692594-51692616 CCCAGCTCCATCTGTACGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954578934 Original CRISPR CTGCTCGTACAGATGGAGCT GGG (reversed) Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
909504202 1:76369539-76369561 CAGCTAGTAATGATGGAGCTAGG + Intronic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG + Intronic
1084400432 11:68939942-68939964 GTGCTCGTGCAGGTGGGGCTTGG + Exonic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1087779642 11:102288621-102288643 CTGCTACAACAGATGGAGGTCGG - Intergenic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG + Intronic
1106136325 13:26976265-26976287 CTGCTGGTACAGATGGAATGAGG - Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1113440086 13:110322173-110322195 CTGCTCCTTCATCTGGAGCTGGG - Intronic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1131433258 15:92403221-92403243 CAGCTAGTAAACATGGAGCTGGG + Intronic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1134127632 16:11627296-11627318 CTGCTGGCAAAGATGGTGCTGGG - Intronic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG + Intergenic
1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG + Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1157333690 18:46721676-46721698 CTGCTGGTACAGATGGAATGAGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG + Intronic
1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG + Exonic
1167055769 19:47111250-47111272 CTGCTCGAGCAGAAGGAGTTGGG - Intronic
936432444 2:112476359-112476381 ATGGGCTTACAGATGGAGCTGGG - Intergenic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
1169554891 20:6738751-6738773 CAGTTCTTACAGTTGGAGCTGGG + Intergenic
1172483749 20:35286781-35286803 CTGCTCGCACGGCTGGAGCTGGG - Exonic
1175224395 20:57436475-57436497 CTGCTCTCTCAGATGGAGCGGGG - Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1181915609 22:26277416-26277438 ACGGTCGTACAGATGGAGCAGGG - Intronic
1182428420 22:30286814-30286836 CTACTCGCACAGGTGGACCTTGG - Exonic
1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG + Intronic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
960285152 3:115819868-115819890 CTGCTCCTACAGAAGGTGATGGG - Intronic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
966501506 3:180646753-180646775 CTGCTAGTACACAGAGAGCTAGG - Intronic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
988930874 5:36034584-36034606 CTTCTCATCCACATGGAGCTGGG + Intergenic
997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG + Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026827078 7:73591163-73591185 CTGATCCTTCAGATGGGGCTGGG - Intergenic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG + Exonic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG + Intronic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG + Intronic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1050923584 9:11235455-11235477 CTGCTCTGTCAGATGGGGCTAGG + Intergenic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG + Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1057952582 9:99381606-99381628 CAGCTCTTTCAGATGGTGCTAGG + Intergenic
1061936986 9:133863413-133863435 CGGGTCGTACAGATGGAACCGGG + Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic