ID: 954578937

View in Genome Browser
Species Human (GRCh38)
Location 3:51692609-51692631
Sequence ACGAGCAGCCTTCCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954578935_954578937 -9 Left 954578935 3:51692595-51692617 CCAGCTCCATCTGTACGAGCAGC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 177
954578934_954578937 -8 Left 954578934 3:51692594-51692616 CCCAGCTCCATCTGTACGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 177
954578933_954578937 17 Left 954578933 3:51692569-51692591 CCTCTGGCTCTCAGGTGCTTGGC 0: 1
1: 0
2: 5
3: 24
4: 295
Right 954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 177
954578931_954578937 24 Left 954578931 3:51692562-51692584 CCTGACTCCTCTGGCTCTCAGGT 0: 1
1: 0
2: 4
3: 39
4: 412
Right 954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954578937 Original CRISPR ACGAGCAGCCTTCCTGCTGC TGG Intronic
900172412 1:1275435-1275457 AGGAGCAGCCCTTCTGCTGTGGG + Intergenic
901423536 1:9166637-9166659 ATGGGCAGCCTCCCTGCTGCAGG - Intergenic
902782704 1:18715002-18715024 CCCAGCGGCCTTCCTCCTGCAGG - Intronic
904673104 1:32180482-32180504 CCGAGGAGCCTGGCTGCTGCCGG - Exonic
905003279 1:34690220-34690242 AAGAGCAGCCTTCCTTCTGTTGG + Intergenic
905293467 1:36939264-36939286 AACAGCAGCCTTTCTCCTGCAGG + Intronic
905661508 1:39729606-39729628 AACAGCAGCTTTGCTGCTGCTGG - Intronic
906684845 1:47756634-47756656 TCCAGCAGTCTTCCTGCTCCCGG - Intergenic
907778095 1:57538463-57538485 GAGAGCACTCTTCCTGCTGCTGG - Intronic
908794255 1:67815888-67815910 GAGAGCAGCCTTCTTGCTGCCGG - Intronic
911664230 1:100535871-100535893 ACGAGCAGCATTCCTGCTGAGGG - Intergenic
912006353 1:104905434-104905456 ACCATCTGCCTTCATGCTGCAGG - Intergenic
912483764 1:110007285-110007307 TCCACCAGCCTCCCTGCTGCTGG - Intronic
912956209 1:114155403-114155425 CCGGGCTGCCTTCCTGCTGGAGG + Intergenic
914193236 1:145428900-145428922 AAGAGCAGCCTTGTTACTGCTGG - Intergenic
916684270 1:167130464-167130486 ACAATCAGCCTTCTTGCTGTGGG - Intergenic
919840397 1:201605093-201605115 ACAAGCAACCTCCCTGGTGCTGG - Intergenic
920045687 1:203130698-203130720 TCCAGCAGCCTTCCTACAGCTGG - Intronic
924000246 1:239543076-239543098 ACAACCAGTCTTCCTGCTGAAGG - Intronic
924381689 1:243471283-243471305 AGGAACAGCCTTGCCGCTGCTGG + Intronic
1068517604 10:58043829-58043851 AAGAGCTGACTTCTTGCTGCTGG - Intergenic
1070598811 10:77851500-77851522 AGGGACAGTCTTCCTGCTGCCGG + Intronic
1071607823 10:87009644-87009666 GCGGACAGCCATCCTGCTGCTGG + Intergenic
1072447738 10:95514333-95514355 ACCAGCTCCCTTCCTGATGCTGG + Intronic
1073042342 10:100616067-100616089 AGGAGCAGCATTCCAGCGGCAGG - Intergenic
1073148669 10:101297075-101297097 AGGAGCATCCTTCCTGCTGTGGG - Intergenic
1074106009 10:110390171-110390193 GAGGGCAGCCCTCCTGCTGCTGG + Intergenic
1075952984 10:126498129-126498151 ACGCAAAGCCTTTCTGCTGCTGG - Intronic
1075980787 10:126737361-126737383 AGCAGCATCCTTCCTACTGCTGG + Intergenic
1076484687 10:130808441-130808463 ACACGCAGCCCTCCTGCAGCCGG - Intergenic
1076700315 10:132269580-132269602 CCGAGCAGCCTTCCTGCCCTTGG - Intronic
1077103216 11:831180-831202 CCAAGGAGCCTTCCTGCAGCCGG + Intronic
1078061338 11:8047001-8047023 ACGTGCAGCCTGCAGGCTGCAGG + Intronic
1083949796 11:65947616-65947638 ACAACCAGCCCTCCTTCTGCAGG - Exonic
1084959247 11:72707598-72707620 CCCAGCAGCCTTCATTCTGCGGG - Intronic
1085961844 11:81470416-81470438 GCAGGCAGCCTTCCTGCTCCTGG - Intergenic
1088157617 11:106827876-106827898 GCGCGCTGCCTTCATGCTGCCGG + Intronic
1089351825 11:117825643-117825665 ACAATCAGGCCTCCTGCTGCAGG + Intronic
1089931799 11:122320354-122320376 TCCGGCAGCCTTGCTGCTGCTGG - Intergenic
1091651548 12:2313967-2313989 ATCAACAGCCTGCCTGCTGCTGG + Intronic
1092533115 12:9361566-9361588 CCGAGCTGCCTTCCAGCTGTGGG - Intergenic
1096657604 12:53101444-53101466 ACCGGCAGCCTTCCTGATTCAGG + Intronic
1097007939 12:55932200-55932222 ACGGGCTGCGTTCGTGCTGCTGG + Intronic
1102631604 12:114285725-114285747 TCTAACAGCCTTCCTGCTACAGG - Intergenic
1102739507 12:115194662-115194684 ACAAGCAGCCTCCCTGCGTCTGG - Intergenic
1104946764 12:132418131-132418153 CCAGGCAGCCTTCCAGCTGCTGG - Intergenic
1105633455 13:22194746-22194768 ATGAGCAGCCTTCCTTCCACAGG + Intergenic
1105778066 13:23680995-23681017 CCGTGCAGCCTGCCTGCAGCTGG + Intergenic
1114570763 14:23666116-23666138 AAGATCAGGGTTCCTGCTGCTGG - Intergenic
1114639101 14:24207120-24207142 ATGCCCAGCCTTTCTGCTGCTGG + Exonic
1114655006 14:24310730-24310752 AGGCACAGCCTTCCTGCTGCTGG + Exonic
1122281040 14:100622543-100622565 ACAAGGAGGCCTCCTGCTGCAGG + Intergenic
1122297041 14:100711619-100711641 GCGAGCAGGCTTCTTGCTGCTGG - Intergenic
1123887882 15:24745637-24745659 ACAAGCAGCCCTCCTGCCACAGG + Intergenic
1124552335 15:30693233-30693255 ACGTGCAGCATTCCTACCGCAGG - Intronic
1124678904 15:31712433-31712455 ACGTGCAGCATTCCTACCGCAGG + Intronic
1125536899 15:40446261-40446283 ACGTGCAGCCTCACTGCTGCTGG - Intronic
1125733733 15:41909274-41909296 TCAGGCAGCCTTGCTGCTGCAGG - Intronic
1127530500 15:59839016-59839038 AGGAGCAGCTTTCCAGGTGCTGG + Intergenic
1128556835 15:68637577-68637599 ACAAGCCGCCTTCCTTCTCCAGG - Intronic
1128718852 15:69930805-69930827 CCTAGCTGCCTTCCTGCTGCAGG - Intergenic
1129115639 15:73363979-73364001 CTGAGCCGACTTCCTGCTGCTGG - Intronic
1132669442 16:1096620-1096642 ACGCACAGCCCTCATGCTGCTGG + Intergenic
1133281336 16:4667112-4667134 AGGCCCAGCCTGCCTGCTGCGGG + Intronic
1136071051 16:27787342-27787364 ACCAGCAGCTTTCTTGCTGCAGG + Intergenic
1136665779 16:31811178-31811200 ACCAGGCGCCTCCCTGCTGCTGG + Intergenic
1138507070 16:57483755-57483777 GCAAGCATTCTTCCTGCTGCAGG - Intronic
1138873963 16:60927015-60927037 AGGAACAGCCTTCCTGATCCTGG - Intergenic
1141727031 16:85796452-85796474 TCCAGCATCCTTTCTGCTGCAGG + Intronic
1142665403 17:1460377-1460399 AAGGGCACCTTTCCTGCTGCAGG + Intronic
1143325728 17:6096922-6096944 ACTAGGAGCCTTCCTGCGGGGGG + Intronic
1143497214 17:7319079-7319101 ACGGGCAGCCTGGCTGCTGCGGG - Exonic
1144327197 17:14193709-14193731 ACCACCAGCCCTCCTGCTCCCGG + Intronic
1144476085 17:15590572-15590594 ACCACCAGCCCTCCTGCTCCCGG + Intronic
1147157619 17:38552181-38552203 CAGAGCAGCCTTCCTGCAGAAGG - Intronic
1147570559 17:41567944-41567966 ACGGGCTGCCTCCCTGCTCCAGG - Intronic
1147606236 17:41775343-41775365 ACTTCCAGCCTTCCTGTTGCAGG - Intronic
1148218936 17:45849116-45849138 CTGGGCAGCCTCCCTGCTGCTGG + Intergenic
1151447739 17:74178181-74178203 ACCAGCTGCCTTCATGCAGCAGG + Intergenic
1151769936 17:76153961-76153983 ATCATCAGCCTCCCTGCTGCAGG - Intronic
1152811186 17:82383460-82383482 ACGAGGCGCATCCCTGCTGCAGG + Intergenic
1156462419 18:37328579-37328601 AAGAGCTGCCTTCCTGGTGAAGG - Intronic
1157288970 18:46396742-46396764 ACCAGCAGCCTTCATGGTGCTGG + Intronic
1159953678 18:74504394-74504416 ACTAGCAGCCTTCAGGTTGCAGG + Intronic
1160016105 18:75141845-75141867 GGCACCAGCCTTCCTGCTGCAGG + Intergenic
1160544737 18:79645418-79645440 TCGACCCCCCTTCCTGCTGCTGG - Intergenic
1160659309 19:290997-291019 CCGCACAGACTTCCTGCTGCCGG + Exonic
1161746640 19:6064167-6064189 ATGAGCAGCCCGCCTGCTCCGGG + Intronic
1163313049 19:16525462-16525484 ACGAGCAGCCGCCCTGGGGCGGG - Exonic
1166141820 19:40809324-40809346 CAGAGCTGCCTTCCTGCTCCAGG + Intronic
925770802 2:7281359-7281381 ACAAGCTGCCTTCGTGCTGTCGG + Intergenic
925891770 2:8440152-8440174 GGGAGCAGCTTTCCTGGTGCAGG + Intergenic
929542877 2:42835878-42835900 CTGAGCAGCTTTGCTGCTGCTGG + Intergenic
931750955 2:65329518-65329540 AGGAGCAGCCCTGCTGCTTCCGG - Intronic
933862130 2:86480270-86480292 ACAGGCAGGCTTCATGCTGCCGG - Exonic
934571311 2:95374826-95374848 AGGGGGTGCCTTCCTGCTGCAGG + Exonic
934986112 2:98886121-98886143 ACCAGCAGCCTGGCAGCTGCTGG + Intronic
940944983 2:159605896-159605918 ACAAACAGGCTTCCTGCAGCGGG + Intronic
941731449 2:168922373-168922395 AAAGGCAGCCATCCTGCTGCAGG + Intergenic
941808418 2:169733233-169733255 AGGAGCAGCCTTTCTGGTGACGG - Intronic
946875548 2:224126171-224126193 GCGAGCAGCCCTCCAGATGCAGG + Intergenic
948784020 2:240341513-240341535 AGGAGCTGCCTTCTTGGTGCAGG - Intergenic
1169337485 20:4768497-4768519 AAGAGCAACTTTACTGCTGCAGG + Intergenic
1169828523 20:9796607-9796629 ACGATCACTCTTACTGCTGCAGG + Intronic
1172167528 20:32908099-32908121 AAGAGTAGCCTCTCTGCTGCTGG + Intronic
1172847845 20:37940450-37940472 AAGATCAGGCTCCCTGCTGCTGG + Intronic
1173411014 20:42809360-42809382 AAGAGCAGCCATCCTGATCCGGG - Intronic
1174349241 20:49955285-49955307 ACCAGCCGCCTCCTTGCTGCAGG - Intergenic
1174948022 20:55010187-55010209 ATGAGCAGCCTTCTTCCTGGTGG - Intergenic
1179831869 21:44001880-44001902 AGGAGCAGCCACCCTGCTGGAGG - Intergenic
1180228147 21:46410176-46410198 AAAAGCAGCCTCCCAGCTGCGGG - Intronic
1180904746 22:19401602-19401624 ACCTGCAGACTTCCTGCTTCAGG + Intronic
1182349266 22:29689870-29689892 TCAAGCAGCCTTGCTGCTGCAGG + Intronic
1182779830 22:32858621-32858643 AGGTGCAGCCTGCCTGCTGTGGG + Intronic
1182988263 22:34741826-34741848 AGGGGCAGCATTCCTGCTTCAGG - Intergenic
1184451110 22:44583378-44583400 ACAAGCAGACCTCCTCCTGCGGG - Intergenic
1184485451 22:44775963-44775985 ACCAGTAGCCTTCCTGATTCTGG + Intronic
1184582319 22:45426052-45426074 AGGAGCTGGCTGCCTGCTGCGGG - Exonic
949944293 3:9177935-9177957 AGGAGCTGCTTTCCTTCTGCAGG + Intronic
954293676 3:49662683-49662705 AAGGGCAGCCTGCCTGCAGCAGG - Intronic
954578937 3:51692609-51692631 ACGAGCAGCCTTCCTGCTGCTGG + Intronic
955774255 3:62416654-62416676 ACCAGCAGCCTCCCAGCTGCAGG + Intronic
956436506 3:69239256-69239278 ACAAGCAGGTTTCCTGCTACAGG - Intronic
956678200 3:71754370-71754392 CCACGCCGCCTTCCTGCTGCTGG + Exonic
962337775 3:134552188-134552210 ACAAAAACCCTTCCTGCTGCTGG - Intronic
962491642 3:135898926-135898948 CCCAGCAGGCTGCCTGCTGCAGG + Intergenic
963664412 3:148164685-148164707 ATCAGGAGCCTTCCTGCTGGGGG + Intergenic
966593290 3:181704225-181704247 AGGGGCTGCCTTCCTGCTGGCGG - Intergenic
967828861 3:193901700-193901722 TCGAGCAGGCTTCCTGCTTGGGG + Intergenic
970053539 4:11945148-11945170 AAGGGAAGCCTTGCTGCTGCTGG + Intergenic
973798498 4:54452086-54452108 ACCATCAGCCCTTCTGCTGCAGG - Intergenic
978648531 4:110971776-110971798 CCCAGCAGCCTTCCTGGTGCGGG - Intergenic
985697445 5:1348796-1348818 ATGAGCAGCCCTCCAGGTGCTGG + Intergenic
985975580 5:3416933-3416955 ACGAGCAGCCCTCCTGAAGTGGG - Intergenic
986715551 5:10521192-10521214 ACAAGCAGCATTTCTGCTGTGGG - Intronic
987363686 5:17129310-17129332 ACGTGCAGCATTCCGGCAGCAGG + Intronic
987709782 5:21492394-21492416 ACGAGGGGTCTTCCTGCTGTAGG + Intergenic
988749831 5:34181769-34181791 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
988797608 5:34666513-34666535 AAGAGCAGGCTTCCAGCTGAGGG - Intronic
989601274 5:43202909-43202931 ACGCTCAGCTTACCTGCTGCTGG + Intronic
989686101 5:44089366-44089388 ACTAGCAGCCTTCCTACTCAGGG + Intergenic
991502342 5:67289585-67289607 ACCGGCAGACATCCTGCTGCTGG - Intergenic
991738090 5:69644973-69644995 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991760104 5:69911451-69911473 ACGAGGGGTCTTCCTGCTGTAGG + Intergenic
991787228 5:70206649-70206671 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991789666 5:70224699-70224721 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991814415 5:70499809-70499831 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991817550 5:70521101-70521123 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991839335 5:70786502-70786524 ACGAGGGGTCTTCCTGCTGTAGG + Intergenic
991879674 5:71207039-71207061 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
991882114 5:71225068-71225090 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
994421902 5:99533713-99533735 ACGAGGGGTCTTCCTGCTGTAGG + Intergenic
994460940 5:100066868-100066890 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
994485087 5:100380296-100380318 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
997249418 5:132377120-132377142 ACCAGCAGTGTGCCTGCTGCGGG + Intronic
999186553 5:149714988-149715010 ATGATCACCCTTCCTGCCGCAGG + Intergenic
999565718 5:152858718-152858740 ACGAGTATGCTTCCTGCTCCGGG + Intergenic
1001713378 5:173795246-173795268 AGCAGGAGCCTTCCTGCTCCAGG - Intergenic
1001931038 5:175673128-175673150 CTGACCAGCCTCCCTGCTGCTGG - Intronic
1002453825 5:179334234-179334256 AGGGGCAGCCTTCCTGCAGAAGG - Intronic
1003360350 6:5419832-5419854 ACCAGGAGCCTGCCTCCTGCAGG - Intronic
1003360501 6:5420872-5420894 ACCAGGAGCCTGCCTCCTGCAGG - Intronic
1003535785 6:6974129-6974151 AGCAGCAGACTTCCTGCTTCAGG + Intergenic
1004103236 6:12637141-12637163 AAAAGCAGCCTTCTTACTGCAGG - Intergenic
1005003412 6:21264938-21264960 ACGAGCAGCCTTCCCACCTCGGG + Intergenic
1005547897 6:26888112-26888134 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
1006121701 6:31810820-31810842 ACAAGCAGCCATCCTGATGGGGG - Exonic
1006152304 6:31996051-31996073 ACGAGCCGTCAGCCTGCTGCTGG - Exonic
1006158607 6:32028789-32028811 ACGAGCCGTCAGCCTGCTGCTGG - Exonic
1006414914 6:33897809-33897831 AAGAGCTGTCTGCCTGCTGCAGG - Intergenic
1009018658 6:57929193-57929215 ACGAGGGGTCTTCCTGCTGTAGG - Intergenic
1018452122 6:163919107-163919129 AGGTGCAACCTTCCTGCTGCTGG - Intergenic
1019413071 7:914993-915015 CCCAGCAGCCTCCCTGCAGCCGG + Intronic
1019617692 7:1973670-1973692 AGCGGCAGCCTCCCTGCTGCAGG + Intronic
1024170886 7:46784843-46784865 AGGAGCAACCTTCTTGCTGTGGG - Intergenic
1024249000 7:47492265-47492287 AAACCCAGCCTTCCTGCTGCTGG - Intronic
1024578523 7:50783172-50783194 TCGAGCAACCTTCCACCTGCAGG + Intronic
1024699084 7:51887517-51887539 GAGAGCATCCTTCCTGCTGCAGG + Intergenic
1025928120 7:65975132-65975154 ACGAGGGGCCTTCCTGCTGGAGG - Intronic
1029129789 7:98321406-98321428 CTGAGCACTCTTCCTGCTGCGGG - Intronic
1034627248 7:152503255-152503277 AGGAGCATCCTTGATGCTGCAGG - Intergenic
1034881773 7:154768096-154768118 ATGGGCAGCGTGCCTGCTGCAGG + Intronic
1035420659 7:158726872-158726894 ACCAGCAGCCTTGCTGCCTCTGG - Intergenic
1036626819 8:10479306-10479328 AAGGGCAGCCCTCCTGCTGCGGG - Intergenic
1039335185 8:36581424-36581446 CTGAACAGACTTCCTGCTGCTGG - Intergenic
1041267966 8:56083393-56083415 AAGTGCAGCCTCCATGCTGCTGG + Intergenic
1048869096 8:138782696-138782718 CCTTGCAGCCATCCTGCTGCTGG - Intronic
1049411831 8:142477025-142477047 CAGGGCAGCCCTCCTGCTGCGGG + Intronic
1050900166 9:10938301-10938323 TCGAGCAACCTTCCTGCCTCAGG + Intergenic
1051143795 9:14005950-14005972 ACACGCAACCTTCCAGCTGCTGG - Intergenic
1053383948 9:37672248-37672270 AGGTACACCCTTCCTGCTGCTGG - Intronic
1057798547 9:98175272-98175294 ACCAGGAGCCTCCCTGCTTCAGG + Intronic
1059668122 9:116468447-116468469 ATGAGCATCCTTCCTGATGCTGG - Intronic
1060665120 9:125428186-125428208 ACAAGCAGCCTTCCTGCCCTGGG - Intergenic
1061860379 9:133464867-133464889 TGGGGCAGCCTTCCTGGTGCTGG + Intronic
1062176126 9:135164081-135164103 GTGAGCAGCCTGCCTGCTGAGGG + Intergenic
1185978723 X:4750924-4750946 AAGAGCAGCCTTCTTTCTCCAGG + Intergenic
1191716766 X:64199090-64199112 ATTTGCAGCCTTCCTGCTGAGGG + Intronic