ID: 954578941

View in Genome Browser
Species Human (GRCh38)
Location 3:51692647-51692669
Sequence CAGTTTGTCAGCTTGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954578934_954578941 30 Left 954578934 3:51692594-51692616 CCCAGCTCCATCTGTACGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105
954578939_954578941 3 Left 954578939 3:51692621-51692643 CCTGCTGCTGGATAATCATCAGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105
954578936_954578941 23 Left 954578936 3:51692601-51692623 CCATCTGTACGAGCAGCCTTCCT 0: 1
1: 0
2: 0
3: 8
4: 71
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105
954578938_954578941 7 Left 954578938 3:51692617-51692639 CCTTCCTGCTGCTGGATAATCAT 0: 1
1: 0
2: 0
3: 18
4: 152
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105
954578935_954578941 29 Left 954578935 3:51692595-51692617 CCAGCTCCATCTGTACGAGCAGC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954578941 Original CRISPR CAGTTTGTCAGCTTGTGAGC AGG Intronic
905251824 1:36654173-36654195 GAGTATATCAGCCTGTGAGCGGG + Intergenic
905450433 1:38052589-38052611 CAGAATGTCAGCCTTTGAGCTGG + Intergenic
910576345 1:88768925-88768947 CAGCTTGTCATCTGGTGAGAGGG + Intronic
917476647 1:175374675-175374697 CAATTTTTCAGCTTGTCAACTGG + Intronic
918050145 1:180966623-180966645 TAGTTTTTCAGCTAGTGAACAGG - Intergenic
918598005 1:186315809-186315831 CAGTGTGTCTGCTTGTGTTCAGG - Intronic
922772399 1:228193226-228193248 CTGTTTGTCTGCTTCTGTGCTGG + Intergenic
1068481171 10:57590441-57590463 CTCTTTGTCAGCTTGTCATCTGG - Intergenic
1069848841 10:71391894-71391916 CAGTGTGCCAGCCTGTGGGCTGG - Intergenic
1071481919 10:86070983-86071005 CAGTGTGTCAGCTTGGGGTCAGG - Intronic
1073775580 10:106782114-106782136 CAGACTGTCTGCTTGTGACCTGG + Intronic
1076307982 10:129478155-129478177 CAGTCTGGCAGCATTTGAGCTGG - Intronic
1077164820 11:1130267-1130289 CAGTTTCTCCGTTTCTGAGCAGG - Intergenic
1077487355 11:2845235-2845257 CAGTGTGTCAGGTAGGGAGCCGG - Intronic
1079457239 11:20647028-20647050 CAGTGTGTGAGCCTGGGAGCTGG + Intronic
1084773368 11:71358467-71358489 CAGTTTGTCAGCAGCAGAGCTGG + Intergenic
1089092790 11:115892233-115892255 CAGTTGGTCTGTCTGTGAGCTGG + Intergenic
1090715389 11:129426046-129426068 CATTTTGTCAGCCTTTGAGTTGG + Intronic
1095216149 12:39551132-39551154 CAGTTTGTGTTCTTGTAAGCAGG - Exonic
1104090848 12:125516548-125516570 CAATTTCCCAGCTTGTGAGCTGG - Intronic
1110578056 13:77083212-77083234 AAGTTTATCAGTTTGTGTGCTGG + Intronic
1111058057 13:82974943-82974965 CAGTTTGGCAGATGGTCAGCAGG - Intergenic
1113748452 13:112762347-112762369 CAGTTTCTCAGAGTATGAGCTGG + Intronic
1114196668 14:20484076-20484098 CAGTTTGTCAGTTTCTCAGAAGG + Intergenic
1114207609 14:20587734-20587756 CAGTTTGCAACCTTGTGAGTAGG - Intronic
1116968990 14:51045143-51045165 CAGCTGCTCAGCTGGTGAGCTGG + Intronic
1118835356 14:69474019-69474041 CAGTTTGTCAAGTACTGAGCAGG - Intergenic
1120976564 14:90254120-90254142 CATTTTGTCAGCATCTGGGCTGG + Intergenic
1127310019 15:57744321-57744343 CAGTTTGTCAGCTGCAGAGCTGG + Intronic
1131488791 15:92844071-92844093 TGGTGTGTCAGCTTGTCAGCGGG + Intergenic
1138715830 16:59021258-59021280 TAGTTTGTCAGGTTATCAGCAGG + Intergenic
1141747008 16:85932634-85932656 CAGGTTGTCAGCAGGTCAGCAGG - Intergenic
1142910840 17:3089566-3089588 CAGTTTCTCAGGTGGTGAGTGGG + Intergenic
1145366515 17:22270580-22270602 CAGTCTGTCACCTTGTGACCAGG + Intergenic
1146412051 17:32594782-32594804 CAGTTTTTAAGCTGGAGAGCTGG + Intronic
1147501567 17:40969295-40969317 CAGTTTGTCATCTTGTCTTCTGG - Intergenic
1153566859 18:6427472-6427494 CAGATGGTCAGCTGGTGGGCTGG - Intergenic
1153759386 18:8316088-8316110 CAGCTTCTCAGCTTCTGAGTTGG - Intronic
1153827569 18:8890213-8890235 TGGTTTGTCAGCTGGTTAGCAGG - Intergenic
1160247013 18:77166922-77166944 CAGTTAATCAGCTGGTGAGCAGG - Intergenic
1161972806 19:7592223-7592245 CACCTTGTCACCTTGTGAACAGG - Intergenic
1162892316 19:13742759-13742781 CAGAATGTCATCTTGGGAGCAGG - Intronic
1163419558 19:17206463-17206485 CAGTTTCTCAGTTTGTGAACTGG - Intronic
1165267242 19:34670303-34670325 CAGTTAGTCAGTTTGTGAAAAGG - Intronic
1165368322 19:35384385-35384407 CAGTGTGTAACCTTTTGAGCTGG + Intergenic
1167602610 19:50463302-50463324 CAGTTTGCCAGCTTCTGGTCTGG + Intronic
928342769 2:30459541-30459563 CTGTTTTTCAGCCTGTGAACAGG - Exonic
929600824 2:43203698-43203720 CAGTTTCTCAGCCTGTGAAATGG + Intergenic
931056662 2:58479932-58479954 CAGGTCGTCCGCTTCTGAGCAGG + Intergenic
931944987 2:67296344-67296366 TAGTTTGTGAGCCTGAGAGCTGG - Intergenic
931990163 2:67782315-67782337 TAATTTGTTAGCTTGTGAACAGG - Intergenic
935054373 2:99552815-99552837 CAGTTTGGGAGACTGTGAGCAGG - Intronic
936027925 2:109047461-109047483 CAGTTTCTCTGCTTGTAATCCGG - Intergenic
937331306 2:121032037-121032059 CAGCTTCCCAGCTTGTGAGAGGG - Intergenic
938738091 2:134204738-134204760 CATTCAGTCAGCTTGTGAACAGG + Intronic
941364444 2:164592649-164592671 CAGTTTTTTAGATTGTGAGTAGG - Intronic
941407574 2:165110048-165110070 CAGTGTGTCAGCTAGTGTCCAGG - Intronic
942526361 2:176857085-176857107 CAGTTTTACAGTTTGTGAGAGGG - Intergenic
942841147 2:180362377-180362399 GAGTTTGTCACCTTTTGTGCAGG + Intergenic
944331702 2:198476100-198476122 CTGCTTGTTAGCTTGTCAGCAGG + Intronic
944496145 2:200307999-200308021 AAGTCTGTCGGCTTGTGAGGGGG - Intronic
945265160 2:207883389-207883411 CAGTTTACCAGTTTGTGTGCTGG - Intronic
947834595 2:233166323-233166345 CACTGGGTCAGCTTCTGAGCAGG + Intronic
1171253850 20:23671256-23671278 CAGTTAGATAGCTTTTGAGCTGG + Intergenic
1174725290 20:52855062-52855084 CAGTTCTTCCGCTTATGAGCTGG - Intergenic
1175177858 20:57124263-57124285 CACTTTGTTAGATTGTGAGAGGG - Intergenic
1179246176 21:39636134-39636156 CAGTTTCTCATCTTTAGAGCAGG + Intronic
1179607051 21:42523385-42523407 CAGTTTGTCAAGCTGTGGGCTGG + Intronic
1184262858 22:43329301-43329323 CAGTCTGTCAGCTTGAGGGGTGG - Intronic
1184788880 22:46687100-46687122 CACTTTCCCAGTTTGTGAGCAGG + Exonic
950232870 3:11291993-11292015 CAGTTTGTCACCTTGTTTGGAGG + Intronic
952491858 3:33881292-33881314 CAGTTTCTCAGCCTCTGATCTGG - Intergenic
954578941 3:51692647-51692669 CAGTTTGTCAGCTTGTGAGCAGG + Intronic
954958916 3:54547601-54547623 CAGTTTGTCAGTTGCAGAGCAGG + Intronic
959975184 3:112450733-112450755 CAGTTTGTCAGCTTACAAGCAGG + Intergenic
961371294 3:126433599-126433621 CAGGCTGTCAGGTTGGGAGCGGG - Intronic
961971127 3:130969849-130969871 CATTTTGTCAGCTTGTAAGCTGG - Intronic
963793126 3:149604628-149604650 CAGCTGGTCAGCATGTGGGCTGG - Intronic
966160416 3:176961777-176961799 TATTTTGTTAACTTGTGAGCTGG - Intergenic
968284425 3:197499686-197499708 CAGATTGTTTGCTGGTGAGCTGG + Intergenic
968678697 4:1900926-1900948 CAGTTTGGCATCGTGTGCGCCGG - Exonic
977006869 4:91578262-91578284 CAATTTTTCAGTTTGTAAGCAGG + Intronic
977329799 4:95623359-95623381 TATTTTGTGAGGTTGTGAGCAGG + Intergenic
982091403 4:151883070-151883092 CAGTTGATCCGCTTGTGACCAGG + Intergenic
990999978 5:61772841-61772863 CAGCATGTCAGCATGTCAGCAGG + Intergenic
992466192 5:77007776-77007798 CATTTTTTCAGCTTGTCTGCTGG + Intergenic
998478373 5:142440708-142440730 CAGTTTGTCTTCCTCTGAGCTGG + Intergenic
1002079418 5:176728556-176728578 CAGTTTCCCAGCCTGTGAGATGG + Intergenic
1004374451 6:15079487-15079509 CAGTATGTCAGCCAGTGTGCTGG - Intergenic
1008506326 6:52234382-52234404 CAGTTCGCCACCTTGTGAGCAGG + Intergenic
1012423951 6:99094209-99094231 CAGTTTCCCAGTTGGTGAGCCGG - Intergenic
1013926737 6:115481589-115481611 AAGTTTGTCAGCTGGTGAACAGG + Intergenic
1015020780 6:128471911-128471933 CTGTGTGCCAGCTTATGAGCGGG + Intronic
1015555257 6:134454453-134454475 CTGTTTGTTAGCTTGGGATCTGG + Intergenic
1016511370 6:144846974-144846996 CAGTTTGTCAGTCTGGGAGTGGG + Intronic
1023296031 7:38715889-38715911 CAGTTTGTCAGTATTTAAGCCGG - Intergenic
1025747361 7:64255135-64255157 CAGTGTGACAGCCTGTGTGCAGG - Intronic
1027602524 7:80256913-80256935 CAATTAGTGAGTTTGTGAGCAGG - Intergenic
1029379009 7:100200409-100200431 CAATGTGTCAGCTTGTAAGGAGG + Intronic
1029439156 7:100577751-100577773 CAGCATGTCAGCAAGTGAGCGGG + Intronic
1031943524 7:127814798-127814820 CAGTTTGTTTGCGTGTGAGAAGG + Intronic
1032555598 7:132830308-132830330 CAGATTGACAGCTTGGGAGCTGG + Intronic
1034837308 7:154364466-154364488 CAGTTTTACAGCTTGTTAACTGG - Intronic
1037668662 8:20996023-20996045 CAGTTCGTCAGAATGAGAGCAGG - Intergenic
1039584809 8:38697601-38697623 CAGGTTGTCAGCCTGTGCACTGG + Intergenic
1041374927 8:57203590-57203612 CGGCCTGTCAGCTTGTGGGCGGG + Intergenic
1043019383 8:74982425-74982447 CAGTTTGACAGCATGTGAGAGGG + Intergenic
1048266964 8:132995905-132995927 CAGTTTATGAGCTTGTGTGTTGG - Intronic
1048521999 8:135164889-135164911 CAGTGAGTCAGCTTGAGAACTGG + Intergenic
1053211937 9:36237101-36237123 CAGTTTGTCAAATTGTGAACAGG + Intronic
1053266013 9:36714181-36714203 CACTTTTTCAGCTTGATAGCAGG - Intergenic
1056503043 9:87229470-87229492 CAGTTTTTCTGCTTGTGATGTGG - Intergenic
1061761811 9:132856714-132856736 CATTTTCTCAGCTTCTGAGCTGG - Intronic
1061930379 9:133829463-133829485 CAGCTTGTCATGTTGTGAGCCGG - Intronic
1190689738 X:52903509-52903531 CAGTTTGTGGCCTTGTGAGGCGG + Intronic
1190696245 X:52952283-52952305 CAGTTTGTGGCCTTGTGAGGCGG - Intronic
1190759434 X:53427427-53427449 ATGCTTGTCAGCTTGTCAGCTGG - Intronic
1191027421 X:55929268-55929290 CCGTTTGTCAGATTGAGAGATGG + Intergenic
1196885145 X:120237262-120237284 ATGATTGTCAGCTTCTGAGCTGG - Intergenic
1199319577 X:146422641-146422663 CAGTTTGTGAGGTTTGGAGCTGG - Intergenic