ID: 954580867

View in Genome Browser
Species Human (GRCh38)
Location 3:51702348-51702370
Sequence CTGGGGCCTCAGCAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 396}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954580856_954580867 11 Left 954580856 3:51702314-51702336 CCTCATTCACAGGCTTCTGTCCT 0: 1
1: 0
2: 1
3: 32
4: 308
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580851_954580867 26 Left 954580851 3:51702299-51702321 CCAGCTCCCTGACCACCTCATTC 0: 1
1: 0
2: 1
3: 50
4: 403
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580850_954580867 27 Left 954580850 3:51702298-51702320 CCCAGCTCCCTGACCACCTCATT 0: 1
1: 0
2: 3
3: 31
4: 370
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580848_954580867 29 Left 954580848 3:51702296-51702318 CCCCCAGCTCCCTGACCACCTCA 0: 1
1: 0
2: 6
3: 50
4: 651
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580855_954580867 14 Left 954580855 3:51702311-51702333 CCACCTCATTCACAGGCTTCTGT 0: 1
1: 0
2: 3
3: 26
4: 324
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580853_954580867 20 Left 954580853 3:51702305-51702327 CCCTGACCACCTCATTCACAGGC 0: 1
1: 0
2: 1
3: 23
4: 267
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580862_954580867 -9 Left 954580862 3:51702334-51702356 CCTGGGAGCCACACCTGGGGCCT 0: 1
1: 0
2: 3
3: 39
4: 349
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580854_954580867 19 Left 954580854 3:51702306-51702328 CCTGACCACCTCATTCACAGGCT 0: 1
1: 0
2: 0
3: 15
4: 221
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396
954580849_954580867 28 Left 954580849 3:51702297-51702319 CCCCAGCTCCCTGACCACCTCAT 0: 1
1: 0
2: 2
3: 43
4: 477
Right 954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954580867 Original CRISPR CTGGGGCCTCAGCAAGAGGA GGG Intronic
900220225 1:1504616-1504638 CTGAAGCCTCAGCAACAAGAGGG + Intergenic
900324543 1:2101993-2102015 CTGGGGCCTTTTCACGAGGAAGG + Intronic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
900634897 1:3658120-3658142 CTGGGGCCAGAGCAAGGGCACGG + Intronic
900675267 1:3881352-3881374 CCGGGGCTTGGGCAAGAGGAAGG - Intronic
900952555 1:5866048-5866070 CTAGGGACTCAGCAAGAAAAAGG + Intronic
901626879 1:10629719-10629741 CTGGGGGCCCAGCAAGTGGTAGG - Exonic
902374295 1:16023037-16023059 CTGGGGGCACAGCAAGGGGCTGG + Intronic
902379248 1:16044914-16044936 CTGGGGCCACAGCAAGGGGCTGG + Intronic
903183791 1:21618492-21618514 CAGGGGACTCAGCGAGATGAGGG - Intronic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904333995 1:29785231-29785253 CTGGGGGCTCAGCACGAGTTGGG + Intergenic
904893960 1:33800241-33800263 CTAGGGCCTCAGCAAGACCCTGG - Intronic
905391632 1:37639470-37639492 CTGGGGCTTCAGCAAGCCCACGG + Intergenic
905544333 1:38785855-38785877 CTGGGGCCTCTGCTAGAAGCTGG + Intergenic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907482924 1:54757164-54757186 CTGAGGCCCCAGCAGGGGGAGGG + Exonic
907752822 1:57279912-57279934 AGATGGCCTCAGCAAGAGGAGGG - Intronic
907790657 1:57660376-57660398 CTGGGGCCCCAAGAAGAGGCCGG - Intronic
908456379 1:64308623-64308645 GTGGCTCCTCAGCAGGAGGAAGG - Intergenic
910529998 1:88225134-88225156 TTGGGAGCACAGCAAGAGGAAGG - Intergenic
912262221 1:108121634-108121656 CAGGAGCCTCAGGAAGGGGAGGG + Intergenic
912755140 1:112318184-112318206 CCGAGGCCACAGAAAGAGGATGG - Intergenic
914956972 1:152171664-152171686 CTGGGGCCTCAGTTAGAGGCAGG + Intergenic
915827641 1:159095420-159095442 CTGAGGGCTCAGGAAGAGAAAGG + Intronic
916162660 1:161934375-161934397 GTAGGGGCTCTGCAAGAGGAAGG + Intronic
917345233 1:174022365-174022387 CCGGAGCCTGAGGAAGAGGAAGG - Intergenic
920771069 1:208886133-208886155 CTGGGGACTGAGCAATAGGAAGG + Intergenic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921717850 1:218436683-218436705 ATGTGGTCTCAGTAAGAGGAGGG + Intronic
922514178 1:226194677-226194699 GTGAGGACTCAGCCAGAGGATGG - Intergenic
922870922 1:228901309-228901331 CTGGGGCCTCTGCAGGTGGCAGG + Intergenic
922880282 1:228975467-228975489 CTGGGGCCTCAGGAACATGGGGG - Intergenic
1063609365 10:7550114-7550136 CTAGGCCCTCAGTAAGAGAAAGG - Intergenic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1064349168 10:14560624-14560646 CAGGGGCCTCAGCAAGAGACAGG + Intronic
1065783193 10:29189748-29189770 CTGAGGGCTCAGCAAGAAGATGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1067432780 10:46254805-46254827 CAGGGGTCTCTGTAAGAGGAAGG - Intergenic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1070144950 10:73767095-73767117 CTGGGGCCTCTGCAATGGGCAGG - Exonic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1071844079 10:89503798-89503820 CTGGGGCCACAGCAACAGGAAGG + Intronic
1071993124 10:91119913-91119935 CTGGGCACTAAGCAAAAGGAAGG - Intergenic
1072682309 10:97516306-97516328 CTGGGTCCTCTGTAAGAGGGAGG - Intronic
1073150557 10:101308619-101308641 CATGGGCCTCTGCCAGAGGATGG + Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1073449118 10:103599156-103599178 CTTGGGCCGCAGTAACAGGAAGG + Exonic
1074704975 10:116122447-116122469 CTAGGGCCTCAGGCTGAGGAAGG - Intronic
1075594863 10:123721657-123721679 CTGGGGGCTCAGGAAGAGTCAGG + Intronic
1076002361 10:126922516-126922538 CTTGGTCCTCACCAAGAGGATGG + Intronic
1076514460 10:131036040-131036062 CTGGTTCCCCAGCAAGAGAAAGG - Intergenic
1076747202 10:132520288-132520310 CTTTGGCCTCAGCTAGAGGGAGG + Intergenic
1076830392 10:132991535-132991557 CTGGGGCCACAGCAAGTTCAAGG - Intergenic
1076872788 10:133201851-133201873 CTGGGGCGGCAGCAGGCGGACGG + Exonic
1077230019 11:1454598-1454620 CTGTGGCCTCACCGACAGGAAGG - Exonic
1077233300 11:1468292-1468314 ACGGGGCCTCAGCCAGAGGGTGG + Intergenic
1077311018 11:1889190-1889212 CTGGGGGCTCAGCTCCAGGATGG + Exonic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077928455 11:6706154-6706176 CTAGGGCCTCAGAAAAAAGATGG + Intergenic
1078543760 11:12231449-12231471 CAGGTGGCTCAGGAAGAGGAGGG - Intronic
1079911376 11:26314692-26314714 CTGGGGTCTCAAAGAGAGGAAGG - Intronic
1081657168 11:44864940-44864962 GTGGGGCATCAGCCAGAGGTTGG + Intronic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1083256963 11:61502553-61502575 CTGAGGGCTCAGGAAGAAGAGGG + Intergenic
1083339165 11:61947565-61947587 CTGGGGCCTCTGGGAGGGGAAGG + Intergenic
1083589924 11:63887791-63887813 GTGGGGGCTTAGCAGGAGGAAGG + Intronic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083889524 11:65588961-65588983 GTGGGGCCTCTGCAGGAGGCAGG + Intronic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084192385 11:67504949-67504971 CTCTGGCCTCAGCCTGAGGAGGG - Intronic
1084216389 11:67648954-67648976 CTGGAGCCTCAGCAAAGGGAGGG + Intronic
1084482898 11:69432350-69432372 CTGGGACCTCAGCCCCAGGACGG - Intergenic
1085475038 11:76784028-76784050 CTGGGACCTCAGGAGGGGGAGGG - Intronic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1087132163 11:94677840-94677862 CTGGGGCCTGAGTAAGAAGTAGG - Intergenic
1088582748 11:111331371-111331393 ATGGGGCCATAGAAAGAGGAGGG - Intergenic
1089770226 11:120797205-120797227 CTGGGGCCACAGCAAAGGCAGGG - Intronic
1091149277 11:133311901-133311923 CTGGGGCCACAGCCAGAGTAGGG + Intronic
1091683272 12:2541947-2541969 CGGGGGCCTCAGGAACAGGCCGG + Intronic
1092646341 12:10577689-10577711 CCAGGGCCTCAGAGAGAGGAAGG + Intergenic
1092901998 12:13068539-13068561 CTGGGGCCAGTGCAAGAGAAGGG + Intronic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1096122516 12:49097453-49097475 CTGTGGCCTCAGCATGGGGTAGG - Exonic
1096411492 12:51379872-51379894 CTGGGGCCTCAGCCTGAGAAAGG + Exonic
1096470466 12:51872212-51872234 CTGGATCCTCAGCAAGATGGGGG + Intergenic
1096490001 12:52007934-52007956 CTGGGGCCAGAGGAAGAGGCTGG - Intronic
1096509964 12:52122193-52122215 CCCAGGCCTCAGCAAGTGGAGGG - Intergenic
1097066497 12:56324448-56324470 CTGAGGCCTCAGGAATAGTACGG + Exonic
1098568417 12:71961164-71961186 GTGGGGACTCAGCTATAGGAAGG - Intronic
1100804097 12:98262847-98262869 CGGGGGCTTCAGAAAGAGGCAGG - Intergenic
1102031424 12:109742048-109742070 CAGGGGCCACAGAAAGAGGCTGG + Intronic
1102515501 12:113443577-113443599 CTTGGCCCTCAGCAAAATGAGGG + Intergenic
1102547992 12:113670456-113670478 CTGGGGCCTCTGGAAGTGGGTGG + Intergenic
1102845044 12:116171574-116171596 CTGGAGCCATTGCAAGAGGAAGG - Intronic
1104629848 12:130391174-130391196 CATGGGCCTGAGGAAGAGGAAGG + Intergenic
1104638354 12:130451569-130451591 TTGGGGGCTCAGGACGAGGATGG + Intronic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1105320982 13:19321979-19322001 TTGGGGCTTCAGGAAGAGAAAGG + Intergenic
1105668693 13:22588620-22588642 CTGAGGGCTCAGGAAGTGGAAGG + Intergenic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1105882191 13:24614725-24614747 TTGGGGCCTCAGCAGAAAGAAGG - Intergenic
1106756156 13:32824915-32824937 CTGGGCCCTGAAGAAGAGGACGG - Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1108450524 13:50558205-50558227 GAGGGGCCTCAGCAGGAGGCAGG + Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113629191 13:111869426-111869448 CTTGGGGCACAGGAAGAGGATGG - Intergenic
1113814860 13:113162945-113162967 CGGGGACCTGAGCAGGAGGAGGG - Intronic
1113821969 13:113221094-113221116 CTGGTGCCACAGCCACAGGAGGG - Intronic
1114080407 14:19198457-19198479 GTGGGGCCTCAGGAGGAAGAGGG + Intergenic
1114567881 14:23645799-23645821 CTGGGGGCTCAGCAAGGTGGTGG + Intergenic
1115780642 14:36764662-36764684 CTGGGTCCTAAGCCAGAGAAGGG - Intronic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119719051 14:76878916-76878938 TTGGGGCCTGAGCAATGGGAAGG + Intergenic
1119766931 14:77196144-77196166 CTGGGGACTGATCAAGAGGAGGG + Intronic
1120959461 14:90111239-90111261 CTGGGGTGTCAGATAGAGGATGG + Intronic
1122134987 14:99627639-99627661 CTGGGGCAACTGCAAGAGGCAGG + Intergenic
1122893229 14:104742581-104742603 CTTGTGCCTGAGCAGGAGGAAGG + Intronic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124422230 15:29532986-29533008 CTGGAGCCTCTACAGGAGGAAGG + Intronic
1124722154 15:32119785-32119807 CTGACATCTCAGCAAGAGGAAGG + Intronic
1127310453 15:57747464-57747486 GTGGGGCCTGAGGAGGAGGAGGG - Intronic
1127564679 15:60175640-60175662 CTGGGGACTCAGCAAGGTGTGGG + Intergenic
1127723486 15:61725566-61725588 CTGGGGTCGCAGAAAGAGAAGGG + Intergenic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130217263 15:81984179-81984201 TTGAGGCCTCATCAAGAGGAGGG - Intergenic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1130844406 15:87731263-87731285 TTGGGCCCTCAGCAATAGGTGGG - Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133018028 16:2953917-2953939 CTGGGGCTTCAGTATGGGGAAGG - Intergenic
1135222208 16:20623011-20623033 CTGGGGCCTCATCCAGACCATGG + Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136542460 16:30935730-30935752 CGGGGGCTTCTGCAAGAGGGAGG + Intronic
1137363890 16:47843944-47843966 CTGGGCCCTAAGAAAAAGGAGGG - Intergenic
1137533065 16:49295734-49295756 TTGGCGCCCCAGCAAGATGAAGG - Intergenic
1138339650 16:56280387-56280409 CTGGGGTCTGAGCAAGATGTGGG + Intronic
1138623378 16:58230138-58230160 CTGGGGAGTCACCAAAAGGATGG - Intergenic
1141497332 16:84419251-84419273 CTGGAGCCTCTGCAGGAGCATGG - Intronic
1141636564 16:85317016-85317038 CTGGGGCCTAAGGCAGAGGCAGG + Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142185987 16:88694964-88694986 CTGGGGACTCAGCAAGGCCAGGG - Intergenic
1142251289 16:88993207-88993229 CTGGGGCCTCCACAAGAGCCAGG + Intergenic
1142373187 16:89694256-89694278 CTGGGGCCTCAGGAAGGGCTGGG + Intronic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1142536903 17:624293-624315 TTGGGCCCTCAGGAAGAGGGAGG - Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143579604 17:7817882-7817904 GTGGGGCCTCAGGAAGGGGGGGG - Intronic
1143815309 17:9507620-9507642 CTGTGCCCTCAGCCAGAGTAAGG + Intronic
1143857822 17:9865395-9865417 CTTGGGCTGCAACAAGAGGATGG - Intronic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1146380072 17:32321713-32321735 CTGGGGCTCCAGTAAGAAGAGGG + Exonic
1147608907 17:41789974-41789996 CTGAGCCCTGGGCAAGAGGAAGG - Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147744841 17:42688725-42688747 CTGGGGCCTCAGGGAGTGGAAGG + Intronic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148322915 17:46768418-46768440 CCGGGGCCACAACACGAGGACGG - Exonic
1148584707 17:48769157-48769179 CTGAGGACTCTGCAAGAGGAGGG + Exonic
1148856236 17:50580619-50580641 CAGGAGCCTGAGCAAGAAGAAGG - Intronic
1149290133 17:55209878-55209900 CTGGAGCTTCACCAAGAGGCAGG + Intergenic
1151174948 17:72280028-72280050 CTGAGGCATGAGCAAGATGAAGG - Intergenic
1152218241 17:79046875-79046897 CTGGCCCCTCTCCAAGAGGAGGG + Intronic
1152341056 17:79725125-79725147 CTGGGGCCTGGGCAACAAGAGGG + Intergenic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152610606 17:81313481-81313503 CTGTGGCCTCTGCAGGAGGGAGG - Exonic
1152829199 17:82486701-82486723 CTGGGGCCTGAGGAAGGAGAAGG + Intronic
1153045079 18:848441-848463 CTGGGGCCTGGGCCAGTGGAAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154107376 18:11534249-11534271 CTGCGGCCACAGCAAGGGCACGG + Intergenic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158302412 18:56066467-56066489 CTGGGGCCTCAGCAGGCCTACGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1158940873 18:62405169-62405191 ATGGGGCCTCACCAGCAGGATGG - Intergenic
1159812971 18:73038997-73039019 CTGGGGCCTCTGGGAGAAGAGGG - Intergenic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160513619 18:79466459-79466481 CTGGGGCCTGAGCACGCGGTTGG + Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161142229 19:2654579-2654601 CTGGGACCTCAGCAAGGGGGAGG - Intronic
1161803237 19:6427242-6427264 CTGGAGCATCTGCAAGAGAAGGG + Exonic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1162523630 19:11195474-11195496 CTGGGGCCTCTGCAGCATGATGG - Intronic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1163354438 19:16800682-16800704 CTGGGGACACATCAAGAAGATGG - Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1165822502 19:38685486-38685508 CTGTGGCCTCAGCAAAGGGCAGG + Intronic
1165855683 19:38878330-38878352 CTGAGGCCCCAGAAAGAGGGAGG - Intergenic
1165917513 19:39269687-39269709 CCGGGGCCTTGGCAAGGGGAAGG - Intronic
1166095103 19:40533468-40533490 CTAGGGGTTCAGCCAGAGGAGGG - Intronic
1166536376 19:43577289-43577311 CTGGGACCTCAGGAAGAGAGAGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166993193 19:46705307-46705329 AAGGGGCCTCAGAAAAAGGAAGG - Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167468522 19:49662894-49662916 CTTGGGCCTCAGCAGGATCAAGG + Intronic
1167472074 19:49680827-49680849 CTGGGGCCTTAGCCAGAGGTCGG + Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167722516 19:51188048-51188070 CTGAGGCCTCAGCAATGAGAGGG - Intergenic
1168400993 19:56086356-56086378 CTGGGGCCTCATCTGGAGGCAGG - Intergenic
925142999 2:1562722-1562744 TTTGTGCCTCAGCAAGATGATGG - Intergenic
925350874 2:3200068-3200090 CTGGGGCCTCACTAAGAGCTGGG + Intronic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
927217450 2:20676036-20676058 CTGGGGCCTCTGCAGGCAGAAGG + Intergenic
928338625 2:30421915-30421937 GAGGGGCCTCTGCAAGGGGAGGG - Intergenic
928398327 2:30960172-30960194 CTGCAGCCTCTGCCAGAGGATGG + Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929606645 2:43239229-43239251 CTGGGGCAGTAGCAAGATGAAGG - Intronic
929700882 2:44161961-44161983 CTGAGGACACATCAAGAGGATGG + Intergenic
929792473 2:45033703-45033725 CTGGGCCCTCAGCTAAAAGATGG - Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
929884065 2:45862990-45863012 GTGGGGCCACAGCAAGTAGAGGG - Intronic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
932315660 2:70780283-70780305 CTGGGTCCTCATCAAGGGTAGGG + Intronic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932494718 2:72140652-72140674 GAGGTGCCTCAGCAGGAGGACGG - Intronic
932824138 2:74924861-74924883 GTGGGGCTTCAGAAAGAGGCTGG + Intergenic
933481243 2:82859464-82859486 CAGGAGGCTAAGCAAGAGGATGG + Intergenic
934808909 2:97265206-97265228 CTGGGGCCTGGGGGAGAGGATGG + Intergenic
934828596 2:97491963-97491985 CTGGGGCCTGGGGGAGAGGATGG - Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
937307215 2:120879626-120879648 GTGGGGCCGCAGCCAGAGGCAGG - Intronic
939441181 2:142252112-142252134 AGGAGGCCTCAGCAAGAGAATGG + Intergenic
939869856 2:147515013-147515035 CTGGGGCCTGACCAAGAGTGTGG + Intergenic
940908130 2:159186898-159186920 CCAGGGCCTCAGTAAGAAGACGG + Exonic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946051809 2:216869186-216869208 CTTGGGCATCTGCAAGAGGTGGG + Intergenic
946157471 2:217816553-217816575 CTGGGGCTTCAGACAGAGAAAGG - Intronic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946484546 2:220088568-220088590 CTCCAGCCTGAGCAAGAGGAAGG - Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947724244 2:232387548-232387570 CTGGGGCCTCAGCTGCGGGAAGG + Intergenic
948789591 2:240370407-240370429 CTGGGGCCTCAGGAGGAGCTGGG - Intergenic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1169366641 20:4997953-4997975 GTGAGGACTCATCAAGAGGATGG + Intronic
1170207244 20:13811583-13811605 GTGGGGCCTCAGCAGGGTGAAGG + Intronic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1170570234 20:17628440-17628462 CTTGGGCCTCAGCAACTGCAAGG + Intronic
1170856920 20:20065358-20065380 TTGGGGTCTGAGCAAGGGGAAGG - Intronic
1171181213 20:23092068-23092090 CTGGGGCCTCAGCCAGTTGCTGG + Intergenic
1171299655 20:24049340-24049362 CTGATGCCTCTGCAAGAGAAAGG + Intergenic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1173655707 20:44698971-44698993 CCGGGGCCTGAGCAAGTGCAGGG - Intergenic
1173862659 20:46294399-46294421 CTGGGGCCTCAGACAGGAGATGG + Intronic
1174395201 20:50242973-50242995 CTCAGGCCACAGCGAGAGGAAGG + Intergenic
1175067381 20:56300994-56301016 CGGGGACCTCAGGAACAGGAGGG - Intergenic
1175280880 20:57803434-57803456 CTGGGACCTGAGCTAGAGGCAGG + Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175643380 20:60649946-60649968 CCGGGGGCCCAGCAAGAGGCAGG - Intergenic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1176197369 20:63843687-63843709 CCGGGGCCTCTGGAAGTGGAAGG + Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1178830505 21:36052840-36052862 CTGGGGCCTCAGGCAGCTGAAGG + Intronic
1178936064 21:36862814-36862836 CTGGAGACTCACCAAAAGGAAGG + Intronic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1179492308 21:41748752-41748774 CTGGGGCTTGAGCAGGAGGAAGG + Intronic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1180142232 21:45899651-45899673 CTGGGGTCTCTGTAAGGGGATGG + Intronic
1180500369 22:15924227-15924249 GTGGGGCCTCAGGAGGAAGAGGG - Intergenic
1181028273 22:20137935-20137957 CTGGGCCCTGGACAAGAGGAAGG + Intronic
1181937320 22:26448233-26448255 ATGGGCCCTCAGCAAATGGAGGG - Intronic
1182041452 22:27241821-27241843 CTGGGCCCTGAGCAGGAAGAGGG + Intergenic
1182681489 22:32083197-32083219 AGAGGGCCTCAGGAAGAGGAAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184514407 22:44953093-44953115 CCTGGGCCTCAGAGAGAGGAAGG - Intronic
1184633660 22:45807468-45807490 CTGGCTCCCTAGCAAGAGGAAGG + Intronic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
1184811021 22:46832099-46832121 GTGGGGGCCCAGCAAGAGGCTGG + Intronic
1185306977 22:50124622-50124644 CCAGGGCCTCAGCATGAGGTGGG - Intronic
1185319507 22:50194002-50194024 CAGGGGGCTCAGCTAGGGGAGGG - Intronic
1185334671 22:50266175-50266197 CTGGGGGCTCAGCCAGGAGAGGG + Intronic
1185369483 22:50454451-50454473 CTGGTGTCTGAGCGAGAGGAGGG + Intronic
1185372952 22:50469361-50469383 CTGGGGCCCCACGGAGAGGAGGG - Intronic
950011908 3:9729956-9729978 CTGGGGCCACATCAAGAGGGAGG + Intergenic
950651759 3:14411587-14411609 CTGGGGACACATCAAGGGGAGGG + Intronic
950665287 3:14491603-14491625 CAGAGGCCTCAGCCCGAGGAGGG + Exonic
950853922 3:16088055-16088077 CTGGGAGCGAAGCAAGAGGAAGG + Intergenic
953259533 3:41324093-41324115 CTGGGGCCTTAGCATCAAGAAGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
958772630 3:98443984-98444006 CTGGTGCCTGAGTATGAGGATGG + Intergenic
958834176 3:99124537-99124559 CTGAGGTCTCACAAAGAGGAAGG + Intergenic
959007765 3:101039855-101039877 ATTGGGCCTCAGCAACTGGAAGG - Intergenic
960019465 3:112932734-112932756 CTGGGGCCTGAGAAACAGCAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961768301 3:129229210-129229232 CTGGGAGATCAGCAACAGGAAGG - Intergenic
962436019 3:135367351-135367373 CTGAGGCCTCAATGAGAGGAAGG + Intergenic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
964663923 3:159151524-159151546 CTAGGGCCACAGCCACAGGAGGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
966328051 3:178779150-178779172 CTGGGGCCTCCTCAAGTAGAAGG - Intronic
968055511 3:195688586-195688608 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
968100282 3:195960011-195960033 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
968971591 4:3798429-3798451 CGGGGGCCTTGCCAAGAGGAAGG - Intergenic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
969462349 4:7335513-7335535 CTCGGGCCGGAGCAAGAGGCGGG - Intronic
969498570 4:7539974-7539996 GTGGGGCCTTTGCAACAGGAAGG - Intronic
969602195 4:8183011-8183033 CAGGGGCCTGACCCAGAGGAGGG + Intronic
971209837 4:24605251-24605273 CTGGTGCCTCAGTATGAGGCTGG - Intergenic
971812700 4:31447538-31447560 CAGGAGGCTAAGCAAGAGGATGG - Intergenic
973735266 4:53865205-53865227 GTGTGGCCGCAGCAAGAGGGAGG - Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
981005248 4:139867835-139867857 CGGTGGCCTCAGCCAGGGGATGG - Intronic
983254155 4:165379342-165379364 CGGCGGCTGCAGCAAGAGGACGG + Exonic
983788579 4:171765026-171765048 TTGGGGCCTAATCAAGAAGATGG - Intergenic
985503425 5:263362-263384 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
985717211 5:1469352-1469374 GTGGGGCCTGTGCAGGAGGAAGG + Intronic
985734268 5:1568923-1568945 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
986687947 5:10290255-10290277 GTGGGGCCTCAGCCAGACGCAGG - Intronic
988739809 5:34059221-34059243 GTAGGGACTCAGCAAGATGACGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
989563355 5:42875899-42875921 CTGTGGCCCCCGGAAGAGGAAGG - Intronic
990988490 5:61662312-61662334 CTGCGGTCACAGGAAGAGGATGG + Intronic
991261792 5:64675837-64675859 CTAGGGCCTCAGCAAGCAAAAGG + Intergenic
991929521 5:71738806-71738828 CTGGGGCCTGAGGAAGCTGAAGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993958613 5:94268396-94268418 GTGGGGCAACTGCAAGAGGAGGG + Intronic
995140049 5:108725826-108725848 CTGTGGCATCAGAAAGAGCAGGG + Intergenic
997586908 5:135048725-135048747 ATGGGCCCTCAGGAAGAGGAGGG + Intronic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
1002186143 5:177455658-177455680 CCGGGGCCTCTGCGAGAGGCTGG + Intronic
1002497407 5:179624456-179624478 CTGGGGCCCTGGCACGAGGAGGG + Exonic
1002601753 5:180357573-180357595 CTGGGGCCTGAGAAAGGGGCAGG + Intergenic
1003114920 6:3277298-3277320 TTGGTGCCTCACCGAGAGGAAGG - Intronic
1003411952 6:5873098-5873120 CTGGGACCTCAGGAAGAGTCTGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1006340733 6:33445209-33445231 CTAGGGCCTGAGGAAGAGGGCGG + Intronic
1006393126 6:33770590-33770612 TTGGGGCCTCTGCAAAAGGAAGG + Intergenic
1006510952 6:34520782-34520804 CTGAGGGCTGACCAAGAGGAGGG + Intronic
1006516628 6:34549202-34549224 CTGGGGCCTCTGGAGCAGGAGGG - Intronic
1007730405 6:43942134-43942156 GTGGGGCCATAACAAGAGGAGGG - Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1007998547 6:46334737-46334759 GTGGGGCCTCAGCAGCAGTAAGG - Intronic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015829895 6:137357639-137357661 CTCAGGCCTCAGGAAGAGTAGGG + Intergenic
1016619883 6:146096362-146096384 ATGGAGCCTAAGTAAGAGGAAGG + Intronic
1018042828 6:159940303-159940325 GTGGGTGCTCAGCTAGAGGAAGG - Intergenic
1018545888 6:164934781-164934803 CAGGCGCCTCAGCAGGATGAGGG + Intergenic
1018812239 6:167306627-167306649 GTGGGGGCGCAGCCAGAGGAAGG + Intronic
1019560010 7:1651215-1651237 CTGGGTCCTCAGGCCGAGGATGG + Intergenic
1019739522 7:2665800-2665822 CTGGGGGCTCAGGAAGAGCTCGG - Intergenic
1019971269 7:4542860-4542882 CTGAGGCCTCAGCGGGAGGCTGG + Intergenic
1022224265 7:28346747-28346769 CTGGGAGCTCAGCCAGAAGATGG - Intronic
1022535481 7:31095844-31095866 CTGGGGCCTCTGCGGGGGGACGG + Intronic
1022712126 7:32861848-32861870 ATAGGGCTTCAGCAAGAGGATGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022911753 7:34905537-34905559 TTAGGGCTTCAGCAAGAGGATGG - Intergenic
1023174529 7:37423082-37423104 CTGGTGCCTCACTAAGAGCATGG - Intronic
1024248833 7:47491079-47491101 CTGTGGCTTCAGCACGAGGCGGG + Intronic
1026914018 7:74109015-74109037 CCGGGGCATCATCAAGAGCATGG + Exonic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028879847 7:95867813-95867835 CTGGGGCCTCAGAAAGACACTGG + Intronic
1029507678 7:100972104-100972126 CAGAGCCCTCTGCAAGAGGAGGG - Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029615927 7:101657150-101657172 CTGAGCCATCAGCAAGGGGAGGG + Intergenic
1034567718 7:151928949-151928971 CTGGGGCCCCATCAGGTGGAGGG + Intergenic
1034953386 7:155316584-155316606 CTGAGGCCTGAGCAAGGGCAGGG + Intergenic
1035018306 7:155785541-155785563 CTGGGGGCTCAGGAAGGGGATGG - Intergenic
1035181636 7:157093571-157093593 CTGTGGCCCCACCAAGAGGTGGG + Intergenic
1035277088 7:157754133-157754155 CTGTGGGCTCAGGAAGAGCAGGG + Intronic
1035455474 7:159006140-159006162 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455527 7:159006368-159006390 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455554 7:159006482-159006504 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035575688 8:703267-703289 GTGGGGCCTTAGGAGGAGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1036990046 8:13582025-13582047 ATGGGGTCTCTGCAAGAGAAGGG + Intergenic
1037463861 8:19139877-19139899 GTGAGGACTCAGCAAGAAGATGG - Intergenic
1037489524 8:19385105-19385127 CTGGGACCAAAGCACGAGGAGGG - Intronic
1037930942 8:22880078-22880100 GTGGGGCCTGAGCAAGGGGATGG + Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038680963 8:29667624-29667646 CTGGGGCAGCAGCAAGAGCCGGG + Intergenic
1039563457 8:38531508-38531530 CTGGGCCCTTGGGAAGAGGAAGG + Intergenic
1039627472 8:39068767-39068789 CTGGGACCTCAGTATGAGGTAGG + Intronic
1039798515 8:40935178-40935200 CTTGGGCCTTAGCAGGAGGTTGG + Intergenic
1042714359 8:71756385-71756407 GTGGGGGCTGAGCACGAGGAAGG - Intergenic
1048298130 8:133230512-133230534 CAGAGGCCTCCGCAAGAGCAGGG - Intergenic
1048549801 8:135423957-135423979 CTGGAGCCTCAGCCATAAGATGG + Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048928568 8:139292380-139292402 CTGGGGCCTCTGCAAGTGAAAGG + Intergenic
1049266582 8:141670966-141670988 CTGAGGCCTCAGGAAGACTAAGG + Intergenic
1049426350 8:142539602-142539624 CTTCGGCCTCAGGAAGTGGACGG - Intronic
1052834430 9:33240155-33240177 CTGGGGCCTGCGCCTGAGGAAGG - Exonic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053042409 9:34885710-34885732 ATGGAGCCTGAGCAAGAGCATGG - Intergenic
1053447099 9:38161178-38161200 ATGGGGTTTCAGCAACAGGAAGG - Intergenic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056422125 9:86438776-86438798 CTGGGGCCTCAGCATCAAGCAGG + Intergenic
1057038976 9:91833720-91833742 CTGGGGCCTCAACACGCAGAAGG + Intronic
1057312082 9:93949013-93949035 CGGGGGCCGCAGCCAGGGGAGGG - Intergenic
1057316040 9:93969127-93969149 CAGAGGCCTCACCAAGAGGTGGG + Intergenic
1057423079 9:94927675-94927697 CTGGGGCAGCAGCCAGGGGAGGG - Intronic
1057519795 9:95751814-95751836 ATGGGGCCTGAGCCACAGGAGGG + Intergenic
1057870335 9:98711862-98711884 ATGGGGCCTCAGCACTGGGAGGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059210567 9:112511088-112511110 CTGTTTCCTCAGCAAGAGGGAGG + Intronic
1059507685 9:114814513-114814535 TTGGGGCCTCCCCAGGAGGATGG + Intergenic
1060943865 9:127558462-127558484 CTGGGGCATGAGAAAAAGGAGGG + Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061873783 9:133534200-133534222 CAGGGGCCTAAGCAGGTGGAGGG - Intronic
1061990358 9:134155352-134155374 CTGGGACTACAGCAAGGGGAAGG + Exonic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062095596 9:134701634-134701656 CAGGAGCCTCAGCACGAGGCTGG - Intronic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1185696622 X:2199688-2199710 CGGAGGCCAAAGCAAGAGGATGG + Intergenic
1187221240 X:17328144-17328166 GTGAGGACTCAGCAAGAAGACGG - Intergenic
1188399236 X:29724168-29724190 CTCCTGCCTCAGCAACAGGAAGG - Intronic
1189304356 X:39975519-39975541 CCAGGGCCTCAGCGCGAGGATGG - Intergenic
1190522418 X:51294010-51294032 CTGGGGTATCAGCAACAGGGTGG + Intergenic
1192503473 X:71667629-71667651 CTGGGGCCACAGGAACAGCAAGG - Intergenic
1197973612 X:132141207-132141229 CTGAGGACTCAGCAAGAAGGTGG + Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic