ID: 954581957

View in Genome Browser
Species Human (GRCh38)
Location 3:51707696-51707718
Sequence CCCCCTCAGCTCCCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954581957_954581965 17 Left 954581957 3:51707696-51707718 CCTGCCCTGGGGAGCTGAGGGGG 0: 1
1: 1
2: 4
3: 48
4: 689
Right 954581965 3:51707736-51707758 GCCTCCGTGGCCAGCACATGGGG 0: 1
1: 0
2: 0
3: 12
4: 168
954581957_954581962 4 Left 954581957 3:51707696-51707718 CCTGCCCTGGGGAGCTGAGGGGG 0: 1
1: 1
2: 4
3: 48
4: 689
Right 954581962 3:51707723-51707745 ATGAAGAGGCTCAGCCTCCGTGG 0: 1
1: 0
2: 2
3: 16
4: 147
954581957_954581963 15 Left 954581957 3:51707696-51707718 CCTGCCCTGGGGAGCTGAGGGGG 0: 1
1: 1
2: 4
3: 48
4: 689
Right 954581963 3:51707734-51707756 CAGCCTCCGTGGCCAGCACATGG 0: 1
1: 0
2: 4
3: 28
4: 294
954581957_954581964 16 Left 954581957 3:51707696-51707718 CCTGCCCTGGGGAGCTGAGGGGG 0: 1
1: 1
2: 4
3: 48
4: 689
Right 954581964 3:51707735-51707757 AGCCTCCGTGGCCAGCACATGGG 0: 1
1: 0
2: 0
3: 13
4: 226
954581957_954581961 -10 Left 954581957 3:51707696-51707718 CCTGCCCTGGGGAGCTGAGGGGG 0: 1
1: 1
2: 4
3: 48
4: 689
Right 954581961 3:51707709-51707731 GCTGAGGGGGCAAAATGAAGAGG 0: 1
1: 0
2: 0
3: 26
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954581957 Original CRISPR CCCCCTCAGCTCCCCAGGGC AGG (reversed) Intronic
900090251 1:917167-917189 CCCCTTCAGCTCCCAAGCCCTGG - Intergenic
900102275 1:966946-966968 CCGGATGAGCTCCCCAGGGCGGG - Intronic
900114989 1:1024577-1024599 CCCTCCGAGCTCCCCAGGTCGGG + Intronic
900115955 1:1027998-1028020 CCCCCTTCTCTCCCCAGGGGAGG + Intronic
900520503 1:3103146-3103168 CCGCCCCAGCTCACCAGGACAGG - Intronic
900624029 1:3600069-3600091 CCGCCTCAGCTGCCCCGGCCTGG + Intronic
900701033 1:4048717-4048739 CCCACTCCCCTCCCCATGGCAGG + Intergenic
900799605 1:4729032-4729054 GGCCCTGAGCTCACCAGGGCTGG - Intronic
901325201 1:8361213-8361235 ACCCCTCAGCTGCCCACGCCAGG - Exonic
901490122 1:9592464-9592486 ACCACTGAGCTCCCCAGGGCAGG + Intronic
901537396 1:9891442-9891464 TCCCCTCAGAATCCCAGGGCTGG + Intronic
901606177 1:10461155-10461177 CCCCCTCGGCCTCCCAGTGCTGG + Exonic
901824622 1:11852900-11852922 CCCACTCAGCTCCTTGGGGCCGG - Intergenic
902113007 1:14098859-14098881 CCCCATCTGTTCCCCAGGGAGGG - Intergenic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902503762 1:16926538-16926560 CTCCCTCCGCTCCCCATGCCAGG - Intronic
902620268 1:17646744-17646766 GCCCCTCACCTCCCCAGGGCTGG - Intronic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
902722783 1:18315162-18315184 CCATCTCTGCTCTCCAGGGCAGG + Intronic
902768050 1:18630094-18630116 CCTCCTCAGGCCCCCAGGCCGGG - Intergenic
902810290 1:18884299-18884321 CCCCCTCTGCTGCACAGAGCTGG - Intronic
902959972 1:19956364-19956386 CCCACCCATCACCCCAGGGCAGG + Intergenic
902985171 1:20150373-20150395 CTACCTCAACTCCCCATGGCTGG + Exonic
904410001 1:30319595-30319617 CCCCCACATCTACCCTGGGCTGG + Intergenic
904495790 1:30885914-30885936 CCCCCTCCTCAACCCAGGGCTGG + Intronic
904768301 1:32867378-32867400 TCCCCTGAGCTTCCCAGGCCTGG + Intronic
905125943 1:35716288-35716310 CCCCCTCAGCTAGCCCTGGCTGG + Exonic
905187293 1:36205601-36205623 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
905451591 1:38060394-38060416 CCCCCGGGGCTGCCCAGGGCAGG + Intergenic
905922774 1:41730323-41730345 CCCCCTCAGCTCTACAGGGGAGG - Intronic
906107523 1:43303867-43303889 CTCCCTGAGCTCCCCCAGGCTGG + Intronic
906142355 1:43541169-43541191 CCATCTCACCTCCCCAGGCCAGG - Intronic
906359252 1:45138711-45138733 CCCCCTGATCTCCCCTGGGGAGG - Intronic
906715999 1:47969773-47969795 CTCCCTCTGAACCCCAGGGCTGG - Intronic
907403469 1:54239815-54239837 CCTCCTCGGCTCCCCATAGCAGG - Intronic
909649681 1:77960230-77960252 CCCCATATGCTCCCCAGGGATGG - Exonic
910115482 1:83727158-83727180 CTGCCTCAGCTTCCCAAGGCCGG + Intergenic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
910803806 1:91170778-91170800 CCCCATCATCTGCACAGGGCAGG + Intergenic
911420691 1:97636961-97636983 CCCACTCAGGTCCCCAGAGTTGG + Intronic
912533012 1:110339875-110339897 CCTCCTCAGCTCCCGGCGGCGGG + Exonic
912643421 1:111369052-111369074 CCCCCTCACCAGCCCAGGCCCGG + Intergenic
912697920 1:111855355-111855377 CCCCCTCATCTTCCAAGGTCAGG + Intronic
912703535 1:111895703-111895725 CCCCCTCCACTCCCCACGGCAGG - Intronic
912927993 1:113929983-113930005 TCCCCTCAGCTCCCTGAGGCGGG + Intronic
915490757 1:156248853-156248875 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
915530769 1:156500934-156500956 GCCCCTCGCTTCCCCAGGGCTGG + Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
915934222 1:160081439-160081461 CCCCCTCCCCTCCCCAGTCCTGG - Intergenic
916254416 1:162772049-162772071 CCCCCTCAGGGCCACTGGGCTGG - Exonic
917386050 1:174475656-174475678 CCACCTCAGCCTCCCAGAGCTGG - Intronic
918293604 1:183133731-183133753 CCACCTCAGCCTCCCAGGGTTGG - Intronic
919212105 1:194500248-194500270 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
919768051 1:201140024-201140046 CACTGTCAGCTTCCCAGGGCTGG + Intronic
920293385 1:204940015-204940037 GGCCCTCAGCTCCCCAGGCTGGG - Intronic
920502574 1:206494493-206494515 ACCCCTCAGCACCCCAAGGAGGG - Intronic
920841189 1:209555373-209555395 ACCCCGCTGATCCCCAGGGCAGG + Intergenic
921705971 1:218323522-218323544 CCCACTCTGGTCCCCAGGACTGG + Intronic
921724827 1:218512138-218512160 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
921726795 1:218533244-218533266 CCACCTCAGCCTCCCAGTGCTGG + Intergenic
922235605 1:223720343-223720365 CTCACTCTGTTCCCCAGGGCTGG + Intronic
922661594 1:227435108-227435130 CCATCTCAGCTCCCCAGGCTTGG + Intergenic
922749603 1:228064377-228064399 CTCCCTCACCTGCCAAGGGCAGG + Intergenic
922758478 1:228109600-228109622 CTCCCTCAGCTCCCCACCCCGGG - Intergenic
922763335 1:228145523-228145545 CCCGCTCAGCACCACAGGCCTGG - Exonic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923496662 1:234531467-234531489 CCCCTGCAGCTCCCCAGCGGTGG + Intergenic
923517090 1:234707046-234707068 CTCACTCAGATTCCCAGGGCCGG - Intergenic
923720552 1:236463538-236463560 CCGCCTCGCCTCCCCAGTGCTGG + Intronic
923745224 1:236693693-236693715 CACCCTCATCTCCGCAGGGAAGG - Intronic
1063030018 10:2225386-2225408 CCCCCTGAGGTCGCCAGGGAAGG - Intergenic
1065318176 10:24484844-24484866 CCCCCTCAGATCCGAAGGGCTGG - Intronic
1065343077 10:24723978-24724000 TCCCCTCCCCTCCCCAGGGGAGG + Intergenic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1066429146 10:35336249-35336271 CCTCCTCCACTCCCCCGGGCTGG - Intronic
1067066014 10:43104808-43104830 CCTCCTCCGCTCCACAGGGGAGG - Intronic
1068536845 10:58249331-58249353 CCACCCCAGCCTCCCAGGGCTGG + Intronic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069571836 10:69498875-69498897 CCCGCTAAGCTCCCCTGGCCTGG - Intronic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1070887915 10:79921106-79921128 GTCCTTCAGCTCCCCAGGCCCGG - Intergenic
1070972488 10:80578996-80579018 CCTCCCCAGCTCCCCATGGTGGG - Intronic
1071797066 10:89018825-89018847 GCCCCTCACTGCCCCAGGGCCGG + Intergenic
1072640411 10:97207213-97207235 CCCTGCCAGCTCCCCAGGGTGGG + Intronic
1072974917 10:100049204-100049226 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1073046718 10:100643517-100643539 TCCCAACAGCTCCCCAGGGTAGG + Intergenic
1073287019 10:102395493-102395515 CCCCCTCCTCCCTCCAGGGCAGG - Intronic
1073426777 10:103459793-103459815 CTCCCTGACCTCCCAAGGGCAGG + Intergenic
1073531056 10:104232279-104232301 CGCACGCAGCACCCCAGGGCGGG + Exonic
1073541012 10:104316133-104316155 CAACCTCAGCCCCTCAGGGCTGG + Intronic
1074500369 10:114018093-114018115 CCCCATGAGCTCCTCAGGACAGG + Intergenic
1074895409 10:117773153-117773175 CCCCCACAGCTTCCAAGTGCTGG + Intergenic
1075514266 10:123096710-123096732 CCCCCTCATCTCCACTAGGCTGG - Intergenic
1076214210 10:128679804-128679826 CCCACTCAGGGCCCCTGGGCTGG - Intergenic
1076590993 10:131581913-131581935 CCCCCTGTGCTTCCCAGGGAAGG + Intergenic
1076626682 10:131825121-131825143 CCCCCTCTGCTCCTGAGGACAGG - Intergenic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076698393 10:132257800-132257822 ACCCATCAGCTGCCCTGGGCTGG + Intronic
1076765781 10:132632255-132632277 GCCAAGCAGCTCCCCAGGGCTGG - Intronic
1077264694 11:1642832-1642854 CTGCCTCAGCTCCCCTGGGAGGG - Intergenic
1077366227 11:2162411-2162433 CCCTCCCAGCTCCCCAGAACAGG + Intergenic
1077542437 11:3153520-3153542 CCCCCGCAGCTTGCCAGAGCAGG - Intronic
1078275381 11:9839985-9840007 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1078515212 11:12016120-12016142 CCCCCTCAGCCCTGCAGGGATGG + Intergenic
1080030735 11:27658145-27658167 CACGCTCAGCTCCCCTCGGCGGG + Exonic
1081770203 11:45645688-45645710 CGCCCTCCGCTCCTCAGGCCTGG - Intergenic
1081831919 11:46121565-46121587 CCCCCGCCGCTCCCGAGAGCCGG + Intergenic
1081892713 11:46557556-46557578 CCACCTCAACCTCCCAGGGCAGG - Intronic
1081977610 11:47245644-47245666 TCCCCTCACCACCCCAGGGAAGG + Intronic
1083890077 11:65591672-65591694 CCCCAGCAGTTCCCGAGGGCAGG - Intronic
1084335536 11:68455533-68455555 CTGCCTCAGTGCCCCAGGGCAGG - Intergenic
1084358011 11:68652311-68652333 CCCCTTCATCTCCCCAGAGGAGG + Intergenic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1085848276 11:80090974-80090996 CCACCCCAGATCCCCAGGACAGG + Intergenic
1088971598 11:114779341-114779363 CCCCCACACCGCCCCAGGCCAGG - Intergenic
1089366831 11:117925826-117925848 CCCACCCAGCTCCCCAGCCCAGG + Intronic
1089560999 11:119343033-119343055 CCCCCTCAGTCAGCCAGGGCTGG - Intronic
1089638496 11:119831982-119832004 CCCCCTCAGAGTCCCTGGGCTGG + Intergenic
1090064048 11:123488381-123488403 CCCCCGGAGCTCTCCAGGCCGGG + Intergenic
1090328135 11:125906575-125906597 CCTCCTCAGCTCCCAAGTGTTGG - Intronic
1090402366 11:126456960-126456982 CGGCCTCAGCTTCCCAGGCCGGG + Intronic
1091165175 11:133469023-133469045 CAACCCCAGCTCCTCAGGGCAGG - Intronic
1091544779 12:1494291-1494313 CCTCCTGAGCAGCCCAGGGCTGG - Exonic
1091751623 12:3025189-3025211 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1092151814 12:6254214-6254236 CCGCCTCGGCTTCCCAGTGCTGG - Intergenic
1092167448 12:6351372-6351394 CCACCTCAGCCCCCAAGTGCTGG - Intronic
1092241659 12:6839654-6839676 CCGTCCCAGCTCCCCAGGCCTGG - Exonic
1095052736 12:37568614-37568636 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1095946926 12:47758926-47758948 CCCCTTCCCCTCCCCAGGACTGG + Intronic
1095956182 12:47807688-47807710 CCCTCTCACCTGCGCAGGGCTGG - Intronic
1096116753 12:49059709-49059731 CCCCCTAAGCCCCCCCGTGCGGG - Intronic
1096251065 12:50032961-50032983 GGCCCTCACCTCCCCAGGGGCGG + Intronic
1097160294 12:57041532-57041554 CCCCCTCTGCACACCAGGCCAGG + Intronic
1097174725 12:57136059-57136081 CCCCCTCAGCCGGCCACGGCTGG + Intronic
1098481530 12:70967386-70967408 TCCCCTCAGCTTCCCAAAGCTGG - Intergenic
1100565431 12:95790293-95790315 CGCGCGCAGCTCCCCATGGCCGG + Exonic
1100679978 12:96908004-96908026 ACCCCGCAGCTCACCAGGCCTGG + Intronic
1101131951 12:101698337-101698359 GCCCCTCCGCTGCCCAGGGGAGG - Intronic
1101482033 12:105107679-105107701 CCGCCTCCGCTCGCGAGGGCCGG - Intronic
1101520305 12:105475996-105476018 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102474852 12:113181902-113181924 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1102569352 12:113818111-113818133 CCGCCTCAGCCTCCCAAGGCTGG - Exonic
1103088362 12:118079578-118079600 CTCCATCAGCTCCCCAGTGCTGG - Exonic
1103956919 12:124582479-124582501 CCACAGCAGCTCCCCAGGGCAGG - Intergenic
1104599487 12:130142824-130142846 CACCCTCAGCTACCCTGGGCCGG + Intergenic
1104652598 12:130546972-130546994 CCCTATCATCTCCCCAGTGCTGG + Intronic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1104943422 12:132405236-132405258 CTCCCTCAGCTGCCCTGGTCTGG + Intergenic
1104953097 12:132451213-132451235 CTTCCTCGGCCCCCCAGGGCTGG - Intergenic
1105016764 12:132790671-132790693 GCCCCTCAGATCTCCAGGGGCGG - Intronic
1108693135 13:52878109-52878131 CCGCCTCGGCTTCCCAGTGCTGG + Intergenic
1110132153 13:72022114-72022136 CACCCTCAGCTTTGCAGGGCTGG + Intergenic
1112434663 13:99383483-99383505 CATGCTCAGCTGCCCAGGGCTGG - Intronic
1113362842 13:109647094-109647116 CCCCCTAAGCTTCACAGGGAAGG + Intergenic
1113880062 13:113619987-113620009 CCTCCTCTGGTACCCAGGGCAGG - Intronic
1114493086 14:23115297-23115319 CCCAGTCAGGTCCTCAGGGCCGG - Intergenic
1115398627 14:32935036-32935058 CCACCCCAGCACCCCGGGGCGGG - Intronic
1116927535 14:50655796-50655818 CCACCTCGGCCCCCCAGTGCTGG - Intronic
1117044612 14:51800420-51800442 CCCCTTGCGCTTCCCAGGGCAGG + Intergenic
1117124442 14:52606549-52606571 CCACCTCAGACTCCCAGGGCTGG + Intronic
1117722189 14:58638453-58638475 CCCCAGTAGCTCCCCAGCGCGGG - Exonic
1118050242 14:62018678-62018700 ACTCCACATCTCCCCAGGGCTGG + Intronic
1118255352 14:64200784-64200806 TCCCCTCAGCTACCCAGTGAAGG + Intronic
1118992594 14:70809582-70809604 CCCCCTGGGGTCCGCAGGGCTGG - Intergenic
1119338106 14:73851789-73851811 CCCCCTCCCCTCCCAGGGGCGGG - Intergenic
1119338913 14:73858303-73858325 CCGCCTCAGCTTCCCAGTGTTGG - Intronic
1119732914 14:76962489-76962511 CCTCCCTGGCTCCCCAGGGCTGG - Intergenic
1119766871 14:77195905-77195927 CCATCACAGCTCCCCAAGGCAGG + Intronic
1119871742 14:78023645-78023667 CCCCCACTGCTACCCAGGGCAGG - Intergenic
1120179448 14:81328723-81328745 CCCCCTTGCCTCCCCAGGGAGGG - Intronic
1122083919 14:99286249-99286271 ACCCCTGAGCCCCCGAGGGCAGG - Intergenic
1122118026 14:99537301-99537323 CCCCATCACCACCTCAGGGCTGG + Intronic
1122179795 14:99946749-99946771 CCGCCCCAGCTCCCTAGCGCAGG - Intergenic
1122269013 14:100560026-100560048 CCCTCTCAGCCCCCCGCGGCTGG - Intronic
1122621058 14:103057754-103057776 CCCGCGCCGCTCCCCAGGCCCGG - Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122768848 14:104088175-104088197 CCCTCTCACCTCCCCAGGGAAGG - Intronic
1122893268 14:104742734-104742756 CTCCCCCAGCTGCCCATGGCAGG + Intronic
1122922326 14:104885171-104885193 GCCCCTCCCCTTCCCAGGGCTGG + Intronic
1122946705 14:105014311-105014333 CTTCCTCTGCTCCCCAGGGCCGG - Intronic
1123190452 14:106564490-106564512 ATCCCTCAGCTCCCCAGGGAAGG - Intergenic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123975849 15:25553913-25553935 CCACCTCAGCTTCCCAGTGCTGG - Intergenic
1124093575 15:26628794-26628816 CTCCCTCAGCTACCCTGGGGGGG - Intronic
1124159137 15:27253305-27253327 CCCTCCCAGCATCCCAGGGCTGG - Intronic
1124578294 15:30928204-30928226 CCTCCTCAGGTTCCCAAGGCTGG - Intronic
1124782861 15:32652247-32652269 CCCCCACTACTCCCCAGAGCCGG - Intronic
1125511949 15:40296864-40296886 GCCCCTGAGATCCTCAGGGCTGG + Exonic
1125843098 15:42824114-42824136 ACCCCTCCGCTCCCAAGGGAGGG + Intronic
1125932091 15:43607655-43607677 CACCCTCAGCTGCCCTGTGCTGG + Intronic
1125945190 15:43707129-43707151 CACCCTCAGCTGCCCTGTGCTGG + Intergenic
1127041672 15:54983940-54983962 CCCCCAGATCTCCCCATGGCTGG + Intergenic
1127122949 15:55786852-55786874 CCTCTTCAGCTCTCCAGGGCAGG + Intergenic
1127901198 15:63342198-63342220 CCCCCTCAGCCCCCCAGACTAGG + Intronic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128566067 15:68700980-68701002 CGCCCCCAGCTCCTCAGGGAGGG - Intronic
1128750310 15:70143998-70144020 CCTCCCCAGCTTCCCAGGCCAGG - Intergenic
1129161902 15:73752179-73752201 CCCCCAAGGCTCCCTAGGGCGGG + Exonic
1129326366 15:74802193-74802215 GCCTGTGAGCTCCCCAGGGCAGG - Intronic
1129451829 15:75655365-75655387 CCCCTTCTGCTGCCCAGGGCTGG + Intronic
1129682645 15:77666496-77666518 CCCTGTGTGCTCCCCAGGGCAGG - Intronic
1129752863 15:78077815-78077837 CCCCCTCAGCCCCCGGAGGCAGG + Intronic
1130101798 15:80900078-80900100 CCCCATCTGCACCCCAGGGTGGG + Intronic
1130255107 15:82322347-82322369 CCACCTCTGCTCCCCACGCCTGG - Intergenic
1130599867 15:85267659-85267681 CCGCCTCTGCTCCCCACGCCTGG + Intergenic
1131201993 15:90406410-90406432 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1131525922 15:93152490-93152512 CTCCCTCACCTCCCCACTGCTGG - Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132587171 16:710653-710675 GCCCCTCTTCTCCCCAGGGTTGG + Intronic
1132595113 16:745676-745698 CCACCTCGGCCCCCCAGTGCTGG + Intronic
1132661675 16:1064302-1064324 AGCCCCCAGCTTCCCAGGGCGGG - Intergenic
1132757355 16:1492419-1492441 CCACCTCAGCTTCCCAGTGCTGG + Intergenic
1132875728 16:2136039-2136061 CACCCTCCGCTCCACAGGGTCGG + Intergenic
1133014369 16:2932580-2932602 CCACCCCAGGTGCCCAGGGCAGG - Intronic
1133033446 16:3022288-3022310 CCCCCCCAACTCCCCAAAGCGGG + Exonic
1134519258 16:14911314-14911336 CACCCTCCGCTCCACAGGGTCGG - Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1134554668 16:15154912-15154934 CACCCTCCGCTCCACAGGGTCGG + Intergenic
1134706928 16:16309969-16309991 CACCCTCCGCTCCACAGGGTCGG - Intergenic
1134816554 16:17210657-17210679 CCCCTTCAGCCTCCCAGTGCTGG + Intronic
1134960612 16:18402155-18402177 CACCCTCCGCTCCACAGGGTCGG + Intergenic
1135292046 16:21248270-21248292 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1136417769 16:30113989-30114011 CACTCCCAGCTGCCCAGGGCTGG - Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137716513 16:50601642-50601664 CCCCGTCAGCTCCCGAGGGAGGG + Intronic
1137743661 16:50804786-50804808 GCCCCTCAGCCCCCAAGAGCTGG - Intergenic
1138138251 16:54543502-54543524 CTCCCTCAGCGCCTCAGGGTGGG - Intergenic
1138435153 16:56994476-56994498 CCTCATCAGCTCCACAAGGCAGG - Intronic
1138530919 16:57633988-57634010 CCAGCTCAGCTCCCCAGCCCAGG - Intronic
1138534176 16:57651191-57651213 CCTCCTCAGGTGCCCACGGCAGG + Exonic
1138566033 16:57833462-57833484 ACACCTCTGCTCCCCAGTGCAGG - Intronic
1139440498 16:66964243-66964265 CCTTCTCTGCTCCCCAGGTCTGG - Intronic
1139465177 16:67150550-67150572 CCCCCTCAGCTGGGGAGGGCGGG - Exonic
1139591741 16:67936718-67936740 CCCCCTCGGGGCTCCAGGGCTGG + Exonic
1140041697 16:71412531-71412553 AACCCTCAGCTCTCCTGGGCGGG - Intergenic
1141694858 16:85614420-85614442 CCGCCTCCCCTCCCCAGCGCCGG + Intronic
1141928647 16:87185970-87185992 CCCCCGCGGCTCACTAGGGCGGG - Intronic
1141976094 16:87517577-87517599 GCATCTCAGCTCCACAGGGCTGG - Intergenic
1142229369 16:88892653-88892675 CCAGCTCAGCTGCCCTGGGCGGG - Intronic
1142239018 16:88936583-88936605 CCCGCTTAGCCACCCAGGGCCGG - Intronic
1142415095 16:89936811-89936833 GCCCCTCAGCTCCAAGGGGCGGG - Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142751013 17:1987595-1987617 ACCCTTCAGGTCCCCAGGTCTGG + Intronic
1142870183 17:2814832-2814854 CCCCCCCAACACCCCAGGGCAGG - Intronic
1143098232 17:4489898-4489920 CCACCTCAGCCTCCCAGAGCTGG - Intergenic
1143658801 17:8312424-8312446 ACGCCTCTGCTCCCCATGGCTGG + Exonic
1144497638 17:15758512-15758534 CTCCCTCAGGAACCCAGGGCAGG - Intergenic
1144629434 17:16862995-16863017 CTCCCTCAGGAACCCAGGGCAGG - Intergenic
1144735397 17:17552791-17552813 CTTTCTGAGCTCCCCAGGGCAGG + Intronic
1145011817 17:19372585-19372607 CATTCTTAGCTCCCCAGGGCCGG + Intronic
1145061907 17:19738948-19738970 CTCCCTCTGGGCCCCAGGGCTGG - Intronic
1145161007 17:20573561-20573583 CTCCCTCAGGAACCCAGGGCAGG - Intergenic
1145373255 17:22324553-22324575 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1145856691 17:28165965-28165987 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1146258282 17:31404375-31404397 CCCAGTCACTTCCCCAGGGCAGG - Intronic
1146285838 17:31573681-31573703 TCCCCTCAGACCCCAAGGGCAGG - Intronic
1146539786 17:33684310-33684332 CCCCCTCCCCACCCCAGGGTCGG - Intronic
1146854525 17:36251944-36251966 CCCCCACACCTCCCCTCGGCCGG + Intronic
1146866094 17:36336432-36336454 CCCCCACACCTCCCCTCGGCCGG - Intronic
1146877783 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147073309 17:37976460-37976482 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147080488 17:38016581-38016603 CCCCCACACCTCCCCTCGGCCGG - Intronic
1147084830 17:38055998-38056020 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147100778 17:38179964-38179986 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147132875 17:38419338-38419360 CCCCCTGCGCCCCCCGGGGCCGG + Intergenic
1147154708 17:38538169-38538191 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1147155655 17:38543436-38543458 CCCCTTCTGCACCCCAGGGTAGG + Intronic
1147342523 17:39762233-39762255 CACCCTCACCTCCCCAGCCCTGG + Intergenic
1147378728 17:40039330-40039352 CCACCACAGGCCCCCAGGGCAGG + Intronic
1147741571 17:42673494-42673516 CCGCCTCTGCTCCCCACGCCAGG - Exonic
1147948502 17:44093746-44093768 CCCCCGTAGCTCCACAGGGCTGG + Exonic
1147981236 17:44275461-44275483 CTCCCTGATCTCCCCATGGCTGG + Intergenic
1148200698 17:45748223-45748245 GCCCCTCACATGCCCAGGGCAGG - Intergenic
1148226385 17:45900656-45900678 CTCCCCCAGGTCCCCAGTGCAGG + Intronic
1148240716 17:45997966-45997988 CTTCCCCAGCTCCCCAGTGCTGG - Intronic
1148678222 17:49457387-49457409 AGCCCTTGGCTCCCCAGGGCGGG - Intronic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149593596 17:57849934-57849956 CACCCTCAGCCCACCACGGCTGG + Intronic
1150083711 17:62263011-62263033 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1150493430 17:65589818-65589840 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
1151463879 17:74272274-74272296 AGCCCTCGGCTTCCCAGGGCTGG + Intergenic
1151628252 17:75291445-75291467 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1151802003 17:76384367-76384389 CCGCCTCAGCTCACCCGGCCAGG + Intronic
1151832980 17:76566606-76566628 CCACCTCAGCTTCCCAGTGTTGG - Intronic
1152185964 17:78856465-78856487 CCCAGGCAGCTCCCCAGGGAAGG + Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1152633305 17:81420335-81420357 CCCACACAGCACCCCTGGGCCGG + Intronic
1152644603 17:81463006-81463028 CCCCCTCGGGGCCCCAGGGAGGG + Intronic
1152768254 17:82152445-82152467 CCCCCTTAGCACCCCAAGCCTGG + Intronic
1152781392 17:82228786-82228808 CCCCCTCTGCTCCTCGGGACTGG - Intronic
1152920530 17:83064328-83064350 GCCCTCCAGCTCCCCAGGCCTGG - Intergenic
1152986915 18:329619-329641 CCCCTTCCTCTCCCCAGGACAGG + Intronic
1153267312 18:3284060-3284082 GCCCCTCCCCTCCACAGGGCAGG - Intergenic
1153480609 18:5543449-5543471 CCCCCGCACCTCCCCGGGGGAGG + Intronic
1153649592 18:7228341-7228363 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1153860706 18:9202073-9202095 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1154222760 18:12471569-12471591 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1156355775 18:36339020-36339042 CCACTTCATCTCCCCTGGGCAGG - Intronic
1157554496 18:48604204-48604226 CTCGCTCTGTTCCCCAGGGCTGG + Intronic
1158897532 18:61929035-61929057 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1159095516 18:63897326-63897348 CCACACCAGCTCCCTAGGGCTGG + Intronic
1160066845 18:75583379-75583401 CCCCCTCACCTACCCAGGACTGG - Intergenic
1160192277 18:76723915-76723937 GCCCCTCTGCTTCTCAGGGCTGG - Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160410610 18:78673295-78673317 CCCCCTCTGCTCCCTTAGGCTGG + Intergenic
1160678851 19:404298-404320 CCCCCACACCCCCTCAGGGCAGG - Intergenic
1160699879 19:500937-500959 CCGCCTCAGCCTCCCATGGCTGG - Intronic
1160844888 19:1161889-1161911 CCCCCGCGGCTCCCCAGGGAAGG - Intronic
1161268418 19:3375746-3375768 CCCCCGAAGCACCCCACGGCCGG + Intronic
1161314549 19:3611716-3611738 TCTCCTCAGCTCACCATGGCAGG + Exonic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161457777 19:4378195-4378217 ACACCTGAGCTCCCGAGGGCAGG - Intronic
1161572819 19:5039786-5039808 CACCCTCAGACCCTCAGGGCAGG - Intronic
1161686193 19:5703851-5703873 CCCCCTCAGCTCCTGGGGGAAGG + Intronic
1161760083 19:6164676-6164698 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1161821115 19:6531742-6531764 CCCCATCAGCACCCCAGGCCAGG + Intronic
1162060314 19:8090782-8090804 TCCCCTCAAAACCCCAGGGCAGG - Intronic
1162302229 19:9850451-9850473 TCCTCTCAGCTCCAGAGGGCTGG + Intergenic
1162824956 19:13245504-13245526 CTGCTTCAGCTCCACAGGGCTGG + Intronic
1162932707 19:13965375-13965397 TCTCCTCTGCTCCCCAGGGGCGG - Intronic
1163157702 19:15448483-15448505 CACCATTAGCTCCCCTGGGCTGG - Intronic
1163262265 19:16198323-16198345 CGCCCTCTGCTCCCCGGCGCCGG + Intronic
1163279546 19:16307156-16307178 GCCCCTCAGGTTCCCAGGCCGGG - Intergenic
1163528125 19:17833600-17833622 CCACCTCAGCCACCCAGTGCTGG - Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163669363 19:18618334-18618356 ACCACTCAGCTGCCCAGGCCGGG - Intronic
1163767202 19:19170303-19170325 CCCAATCAGCTCCCGGGGGCAGG - Intronic
1164573038 19:29387740-29387762 CTCCCGCAGCTCATCAGGGCTGG + Intergenic
1165318991 19:35074495-35074517 TCCCCTCAGAGCCCCAGGGCAGG - Intergenic
1165570313 19:36770287-36770309 TCCCCTCCACTCCCCAGGGGTGG + Intronic
1165648647 19:37467245-37467267 CCCCCGCGGCTCACCCGGGCGGG + Exonic
1165694599 19:37891409-37891431 CCACCTCAGCGTCCCAGTGCTGG + Intronic
1165741267 19:38206552-38206574 CCCCATCAGCTTCGAAGGGCTGG - Exonic
1165747492 19:38238657-38238679 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1165793904 19:38507508-38507530 CCACCTCTGTTCCCCAGGGCCGG - Intronic
1165898471 19:39156860-39156882 CCCCCTCCCCTCCCGAGGCCTGG - Intronic
1166090921 19:40508357-40508379 GCCCCACAGCTCCCCATGGTGGG - Intronic
1166393662 19:42423915-42423937 CCCACTCACCTTCCCAGGGAGGG + Intronic
1166809445 19:45506925-45506947 CCTCCTCACCTTCCCGGGGCGGG + Intronic
1167103965 19:47419714-47419736 CCTCCTCTCCTACCCAGGGCTGG + Intergenic
1167566216 19:50258952-50258974 AACTCTCAGTTCCCCAGGGCAGG + Intronic
1167567843 19:50267991-50268013 CCCCCTCAGGTCCCCATCTCAGG - Intronic
1167776985 19:51564868-51564890 CCCCCTCACCTCCCCACAGCAGG + Intergenic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
1168243513 19:55098720-55098742 TCCCCTCAGCTCCTCAGAGGAGG - Intronic
924962585 2:46939-46961 TCCCCCCACCTCCCCCGGGCAGG + Intergenic
925046410 2:776289-776311 CCCCCGCAGCTGCCAATGGCCGG - Intergenic
925183288 2:1830717-1830739 CCTCCACAGTTCCCCAGGCCTGG - Intronic
925868785 2:8251523-8251545 CGACCTGAGCTCCCCAGGGTGGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
926983400 2:18595375-18595397 CCCCATCATATTCCCAGGGCAGG + Intergenic
927506801 2:23620206-23620228 CCCTCTCACCACCCCTGGGCTGG - Intronic
927647413 2:24886776-24886798 CCCCTTCCCCTCCCCAGGGCAGG - Intronic
927697468 2:25247824-25247846 GCCCCCCAGATGCCCAGGGCTGG - Intronic
927869751 2:26615995-26616017 CCCCCACCGCCCCCCAGCGCTGG - Intronic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
928212212 2:29331673-29331695 CCCCGTCAGCTCCCCAGGCAAGG - Intronic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
931685077 2:64785615-64785637 CCCACTCAGAGCCCCAGGGGAGG + Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932432559 2:71684712-71684734 CCCCCTCAGCAGGCCGGGGCCGG - Intronic
932463656 2:71899125-71899147 TCCCCTCACCTCCCCTGAGCAGG - Intergenic
932793443 2:74675022-74675044 CCCCCTCACCTCTCCAGGTCTGG - Exonic
933805688 2:85996864-85996886 CCCCTCCAGCTCCCCAGGCCTGG - Intergenic
934136276 2:88999276-88999298 CCCACTAAGCCCCACAGGGCTGG - Intergenic
934579536 2:95427340-95427362 GCCCCTCCGCCCCGCAGGGCTGG - Intergenic
934599908 2:95649385-95649407 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
934652752 2:96101764-96101786 CCCTCCGAGCTCCCTAGGGCTGG - Intergenic
935002519 2:99033591-99033613 CCACCTCAGCCTCCCAGTGCTGG - Intronic
935064010 2:99632539-99632561 CCTTCTGAGCTCCCCGGGGCTGG + Intronic
936516240 2:113183158-113183180 CCTCCTCAGCTCCCCACTGTGGG - Exonic
936533251 2:113291389-113291411 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
937239142 2:120449223-120449245 TGCCCTGAGCTCCCCTGGGCAGG - Intergenic
937267970 2:120629379-120629401 GCCCTCCAGCTGCCCAGGGCTGG + Intergenic
937325206 2:120986164-120986186 CACCCTCAGCCCCTCAGGGTGGG + Intronic
938947448 2:136226045-136226067 CCCCCTCAGCACTCCCTGGCAGG + Intergenic
940323104 2:152398008-152398030 CCGCCTCAGCCTCCCAAGGCTGG - Intronic
940859986 2:158761528-158761550 CCATCCCAGCTCCCCAGTGCTGG - Intergenic
940943686 2:159592395-159592417 CTGCCTCAGCTTCCCAGTGCTGG + Intronic
942533289 2:176935550-176935572 CCCTCTCAAATCCCCACGGCAGG + Intergenic
945198313 2:207257682-207257704 CCCCCTCAGGTACACAGAGCTGG + Intergenic
945258869 2:207825776-207825798 CACCATCAGCTACCCAGAGCTGG - Intergenic
945576061 2:211530638-211530660 CCACCTCAGCCCCCAAGTGCTGG - Intronic
945737190 2:213615341-213615363 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
946035999 2:216742720-216742742 CTCTCTCAGCTCCCAAGGGAAGG - Intergenic
946038814 2:216766243-216766265 GCCCCGCTTCTCCCCAGGGCTGG - Intergenic
946172308 2:217902705-217902727 CCCGCTCTGCTCCACCGGGCGGG + Intronic
946310259 2:218879242-218879264 CTCCTTCAGTTCCCCAGGGATGG + Intergenic
947544265 2:231000309-231000331 CCGCCCCAGCCTCCCAGGGCAGG + Intronic
947622095 2:231597343-231597365 CCGGCTCGGCTCCCCGGGGCTGG + Intergenic
947932494 2:233975328-233975350 CCTCTCCAGCTCCCCAGCGCTGG - Intronic
948179964 2:235972024-235972046 CCACCTCAGCCTCCCAGTGCTGG + Intronic
948466095 2:238152241-238152263 GCCCCTCTGGTCCCCAGGGGCGG - Exonic
948487061 2:238288019-238288041 CGCCCTCAGGTTCCCAGGCCTGG + Intronic
948493611 2:238330629-238330651 CCCACCCACCTCCCCTGGGCAGG - Intronic
948684319 2:239660409-239660431 CCCACTCTGCTCCCCACTGCGGG + Intergenic
948742573 2:240057306-240057328 CTCCCGCAGCTCTCCAGGGTAGG - Intergenic
948791232 2:240377915-240377937 GCCCGACCGCTCCCCAGGGCTGG - Intergenic
1169509657 20:6249816-6249838 TGCCCTCATCACCCCAGGGCTGG - Intergenic
1170578134 20:17680256-17680278 GCCCCCCAGCTGCACAGGGCGGG + Intronic
1171529538 20:25843774-25843796 TCCCCTCCACTCCCCAGGGGTGG + Intronic
1171547288 20:26012106-26012128 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1172163894 20:32887007-32887029 CCCTCTCTCCTGCCCAGGGCTGG - Intronic
1172391048 20:34565505-34565527 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1172591165 20:36119226-36119248 CACCCTGCTCTCCCCAGGGCTGG - Intronic
1172596679 20:36154961-36154983 CCCCCGTTCCTCCCCAGGGCTGG - Intronic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172872582 20:38144882-38144904 GCCCCTCAGCTGCCCACTGCAGG - Intronic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1174165359 20:48580207-48580229 CCCCCTCCCCTCCCCGGGCCTGG + Intergenic
1174399035 20:50265955-50265977 CCCCCTCAGCTGCTCTGTGCTGG - Intergenic
1174416794 20:50372857-50372879 CCCCCTCACCCTCCCAGGGAAGG + Intergenic
1175178536 20:57128575-57128597 TCCCCTCGGCTGCCCAGAGCAGG + Intergenic
1175746344 20:61459850-61459872 CCCACACACCACCCCAGGGCAGG + Intronic
1175793428 20:61756705-61756727 CTCCGTGAGTTCCCCAGGGCTGG + Intronic
1175812167 20:61864257-61864279 CCCCGTCAGCTCCAGAGGCCAGG - Intronic
1175926271 20:62473145-62473167 CCCCCAGAGCGCTCCAGGGCTGG + Intronic
1175952233 20:62589552-62589574 CCCCCGGACCTCCCCAGGCCAGG - Intergenic
1176056842 20:63153257-63153279 CCACCTCAGCCCCATAGGGCAGG - Intergenic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1176179393 20:63742298-63742320 CCCCTTCAGCTCCCACTGGCTGG + Intronic
1176248641 20:64109576-64109598 CTTCCTCTGCCCCCCAGGGCTGG + Intergenic
1176515745 21:7782004-7782026 CCAACTCGGCTCCCCAAGGCTGG - Intergenic
1178082214 21:29077366-29077388 GCCCCTCAACTGCCCGGGGCCGG + Intergenic
1178404991 21:32316616-32316638 GCCCCTCAGCCCCACAGAGCCGG + Exonic
1178522942 21:33301626-33301648 CCCCATCAGCTCCATAGGGCAGG - Intergenic
1178649773 21:34412016-34412038 CCAACTCGGCTCCCCAAGGCTGG - Intergenic
1178948391 21:36966676-36966698 CCGCCCCAGCGCCCCAGGCCCGG + Intronic
1179126989 21:38599354-38599376 GCCCCACAGCTCTCCATGGCAGG - Intronic
1179418190 21:41215108-41215130 CTGCCTCAGCTCTCCATGGCCGG - Intronic
1179564366 21:42237395-42237417 CCACCTCATCTCCCCAGGCTAGG + Intronic
1179641608 21:42751312-42751334 CACCGTCAGCGGCCCAGGGCTGG - Intronic
1179722603 21:43324152-43324174 CACCCTCAGCTCCCCATCCCAGG + Intergenic
1179899030 21:44379419-44379441 CACCCGCAGCACACCAGGGCGGG + Intronic
1179899225 21:44380347-44380369 GCCGCTCAGCTCCCCATGTCAGG + Intronic
1179961704 21:44771040-44771062 CCCCCTCAACACTCCAGGGAGGG + Exonic
1180083676 21:45497977-45497999 CCCCCTCCCCTCCACGGGGCCGG + Intronic
1180832998 22:18915531-18915553 CCCCACCAGCTCCCGAGTGCTGG + Intronic
1180857725 22:19058921-19058943 CACCAGCAGCTCCCCTGGGCAGG - Intronic
1181013938 22:20057545-20057567 CCACCTGAGCTCCCAAGAGCTGG + Intronic
1181032628 22:20155615-20155637 CCTCCTCCGCTGCCCAGGGATGG + Intergenic
1181066822 22:20310723-20310745 CCCCACCAGCTCCCGAGTGCTGG - Intergenic
1181133506 22:20748531-20748553 CCCCCTGTGGTCCCCAGAGCAGG - Intronic
1181327063 22:22058042-22058064 CCCCCCAAACTCCCCAGGGCTGG + Intergenic
1181333251 22:22111125-22111147 ACCCCTAAACTCCCCAGGGCTGG + Intergenic
1181357066 22:22304604-22304626 CCTGCTCAGCACCCCTGGGCAGG - Intergenic
1181518880 22:23433972-23433994 CCACCTCAGGCCTCCAGGGCCGG + Intergenic
1181553186 22:23652658-23652680 CCCCCTGGGCTCCCCAAGGTTGG + Intergenic
1181771800 22:25131209-25131231 TGGCCTCAGCTCTCCAGGGCTGG - Intronic
1182277047 22:29196193-29196215 CCCTCACAGCTTCCCGGGGCTGG + Intergenic
1182631137 22:31686353-31686375 CCGCCTCGGCTTCCCAGTGCTGG + Intronic
1183104024 22:35603257-35603279 CCTCGTCAGCTCCCCGAGGCAGG + Intergenic
1183241314 22:36660001-36660023 CCCCATCTGCTCCCCAGAGGAGG - Intronic
1183354407 22:37350668-37350690 TCCCATCAGCACCCCAGGGTGGG + Intergenic
1183608919 22:38884145-38884167 CCCCCTCAAGACCCCAGGGAAGG - Intergenic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
1183712896 22:39516453-39516475 CCGCCTTAGCTTCCCAGTGCTGG - Exonic
1184066503 22:42124658-42124680 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184068971 22:42136810-42136832 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184164869 22:42721009-42721031 CCCTCGCTGCTCCCCGGGGCGGG + Intronic
1184318482 22:43719108-43719130 GGCCGTGAGCTCCCCAGGGCAGG - Intronic
1184441966 22:44522672-44522694 CCCCCTCAGCTCACCCTGCCAGG + Intergenic
1184770618 22:46594679-46594701 CCCTCCTAGCCCCCCAGGGCAGG - Intronic
1184807324 22:46803461-46803483 CCGCCTCAGCTCCTGGGGGCCGG - Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
1185257728 22:49845370-49845392 GCACCCCAGCTCCCCAGGGCTGG - Intergenic
1185294583 22:50046865-50046887 CCCCCTCAGCACCCAAAGCCCGG + Intronic
1185302237 22:50087948-50087970 GCCCCTCAGCTCCCCAGCTCGGG - Intergenic
1185362134 22:50414704-50414726 CCCCCCCCGTTCCCGAGGGCAGG + Intronic
1203283082 22_KI270734v1_random:140835-140857 CCCCACCAGCTCCCGAGTGCTGG + Intergenic
950262892 3:11554973-11554995 CCCCCTCTGCTGCCCAGGAGTGG + Exonic
950430552 3:12948441-12948463 CCCCATGAGCTCCCCAGTCCAGG - Intronic
950525589 3:13520935-13520957 CCCCTTCAGCCCCACAAGGCAGG + Intergenic
950673409 3:14540367-14540389 CTCCCTCCCCTCCCCAGGGAGGG + Exonic
951619728 3:24587965-24587987 TCCCCTCAGCTCCCCATTTCTGG + Intergenic
952881333 3:37987752-37987774 CCCCCTCAGCTTCTCAGAGAAGG + Intergenic
953411122 3:42691012-42691034 CCCCCTTGCCTCCCCAGGGTGGG - Intronic
953459771 3:43073035-43073057 GCCCCACAGCTTCCCAGGGTGGG - Intergenic
953607183 3:44419681-44419703 GCCCATCAGCTCCACAGGGTGGG - Intergenic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
953914059 3:46906677-46906699 TCCCCTCAGACCCCCAGAGCAGG - Intergenic
953947809 3:47164154-47164176 GCCCCTCAGCTTCGCAGGCCCGG + Intergenic
954028007 3:47798390-47798412 CCGCCTCAGCCTCCCAGTGCCGG + Intergenic
954118069 3:48478217-48478239 CCTCCTCAACACCTCAGGGCTGG - Intronic
954175428 3:48841131-48841153 CCGCCTCGGCCCCCCAGTGCTGG + Intronic
954185348 3:48912796-48912818 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954638066 3:52082244-52082266 GGCCCTCAGCTCCCCTGCGCTGG - Intronic
955064814 3:55525302-55525324 CCCCCTCAAATCCCCAGTCCTGG - Intronic
955229379 3:57085384-57085406 CGCCATCAGCTACCCAGGCCAGG + Intergenic
955286220 3:57644333-57644355 CTCACTCTGTTCCCCAGGGCTGG + Intronic
956038381 3:65120081-65120103 CCCCCTGTGCTTCCCAGGGGAGG - Intergenic
956822099 3:72963323-72963345 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
956826012 3:72997201-72997223 CCCCTCCACCTCCCCAGGGGCGG + Intronic
958026650 3:88058423-88058445 CTCCTCCAGCTCCCCAGGCCCGG + Intronic
959839703 3:110960135-110960157 CCCCTTCCCCTCCCCAAGGCAGG - Intergenic
961481140 3:127181687-127181709 CTGCCTCAGCCCCCCAGTGCTGG - Intergenic
961754687 3:129121076-129121098 CCCCCCCAGCAACCCACGGCCGG + Intronic
961760794 3:129166026-129166048 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
961793480 3:129393134-129393156 CCAACTCAGCCCCTCAGGGCCGG + Intergenic
961807477 3:129499752-129499774 CCAACTCAGCCCCTCAGGGCCGG + Intronic
961812133 3:129528002-129528024 GCCCCTGAGCTCCTCTGGGCAGG + Intergenic
962422087 3:135237805-135237827 AGCCCCCAGCTCCCCAGTGCAGG - Intronic
963028405 3:140942254-140942276 CCCCCTCACCACCCACGGGCTGG - Intronic
963039442 3:141057975-141057997 CAGCCTGAGATCCCCAGGGCAGG + Intronic
963962402 3:151323843-151323865 CCCCCTGAGCTCTCAAGTGCTGG + Intronic
966276185 3:178172871-178172893 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
966882178 3:184356734-184356756 CCTCCTCAGGTCCTCTGGGCTGG - Intronic
966909651 3:184551873-184551895 CCTCCTCAGCTCCGCATGGTGGG - Intronic
968123607 3:196143039-196143061 CCTCCGCAGCTCCCCAGGGCGGG + Intergenic
968284980 3:197503206-197503228 CGCCCTCAGCCCCACAGGACTGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968551002 4:1223314-1223336 CCCCACCAGGACCCCAGGGCTGG - Intronic
968662911 4:1806180-1806202 CCACCCCCGCACCCCAGGGCCGG - Intronic
968703738 4:2068852-2068874 CCCCCTGTGCTCCCCAAGCCTGG - Exonic
968753034 4:2400066-2400088 TCCCCGGAGCTCCTCAGGGCGGG + Intronic
969098065 4:4749224-4749246 CCAGCTGAGCTCCACAGGGCTGG + Intergenic
969174552 4:5388587-5388609 GACCCTGAGCTCCCCAAGGCTGG - Intronic
973197587 4:47463415-47463437 CCTCCTAGGCTCCCCAGGGAAGG + Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
976782398 4:88775454-88775476 CCACCTCAGCCTCCCAGTGCTGG - Intronic
978408432 4:108404072-108404094 CCCCTTCAGCTCCTCTGAGCAGG - Intergenic
978759649 4:112343003-112343025 TCCCTTCAGCTCCCCAGTCCTGG + Intronic
979649505 4:123114244-123114266 CCCACTCTGGTCCGCAGGGCTGG + Intronic
980989710 4:139728790-139728812 CACCCTGTGCTCCCCAGGGTCGG + Intronic
981719805 4:147789881-147789903 TCTCATCAGCTCCCCAAGGCAGG + Intronic
983015456 4:162607345-162607367 CTTCCACAGATCCCCAGGGCAGG - Intergenic
983163188 4:164442863-164442885 TCCACTCAGCTCCCCAGTGCTGG - Intergenic
983637193 4:169909825-169909847 CCAGCACTGCTCCCCAGGGCTGG - Intergenic
985610410 5:884810-884832 CCCCATGAGCTCCGCAGGGAGGG + Intronic
985631504 5:1016410-1016432 CCCCTCCAGCTGCCAAGGGCTGG - Intronic
985634440 5:1028875-1028897 AAGCCTCAGCTTCCCAGGGCGGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986329201 5:6705026-6705048 CCCCACTAGCTCCCCATGGCTGG + Intergenic
986748200 5:10761792-10761814 CCGTCTCTGCTCCCCAGCGCTGG - Intergenic
987720649 5:21628204-21628226 CCCCTTCAGCTTCCCAGGTGAGG + Intergenic
988996637 5:36721652-36721674 CCTCCCAAGCTCCCCAGGGTGGG - Intergenic
989349894 5:40474380-40474402 CCACCTCAGCTCAGCAAGGCAGG - Intergenic
990269161 5:54116146-54116168 CCCCTCCTGCTCCCCAGGGATGG - Intronic
991409845 5:66334998-66335020 TCAGCCCAGCTCCCCAGGGCAGG - Intergenic
992198303 5:74361123-74361145 CTCCCTCAGCTCAGAAGGGCTGG - Intergenic
996399539 5:123046552-123046574 CCCCTTCAGATGCCCAGGGAGGG - Intergenic
997255730 5:132426682-132426704 CTTCCTCTGCTCCCCAGCGCCGG - Intronic
997414615 5:133715855-133715877 CCCACTCAGCTCCACAGAGTGGG + Intergenic
997612863 5:135227389-135227411 CCTCTTCAGCTGCCCAGGGCTGG + Intronic
999180223 5:149664955-149664977 GGCCATCAGCTCCCCAGGGTCGG + Intergenic
1001051535 5:168418289-168418311 TCCCCACTGCTCCCCAGAGCTGG + Intronic
1001256251 5:170185570-170185592 CCCCCTCAGCTTCTCAGAGGAGG + Intergenic
1001559162 5:172658257-172658279 CCCGCTAAGCTCCGTAGGGCTGG + Intronic
1001631807 5:173180946-173180968 CCCCCTCTCCTCCCCACAGCTGG + Intergenic
1002103925 5:176870587-176870609 AGCCCCCACCTCCCCAGGGCTGG - Intronic
1002433850 5:179219764-179219786 CCCCCTCTTCACCCCAGGGCTGG + Intronic
1002494235 5:179600943-179600965 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1002635866 5:180608535-180608557 CCCGCTAAGCCCCACAGGGCCGG + Intronic
1002693395 5:181066599-181066621 CCCACTCAGGTCCGCAGGACTGG + Intergenic
1002720971 5:181261344-181261366 CCTTCTCAGCTCCCTCGGGCCGG + Intergenic
1003183179 6:3809242-3809264 TTCCCTTAGCTCCCCAGGGTTGG - Intergenic
1003870588 6:10399561-10399583 CCTCCCCAGCCCCCCAGGCCAGG - Intronic
1004165704 6:13254938-13254960 ACCTCTTAGCTCCCCAAGGCAGG + Intronic
1004504539 6:16237712-16237734 CCGCCTCAGCTTCCCAGTGTTGG - Intergenic
1004510326 6:16279276-16279298 CCCTCTCAGGGCCCCAGGGAAGG + Intronic
1004788556 6:18997653-18997675 GCCCCTCGTCTCCTCAGGGCTGG - Intergenic
1005959503 6:30685626-30685648 ATCCCGCATCTCCCCAGGGCTGG + Exonic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006103075 6:31698770-31698792 CCCCCTGATCTCTGCAGGGCTGG - Intronic
1006133227 6:31880971-31880993 ACCCTGCTGCTCCCCAGGGCTGG - Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006406750 6:33849960-33849982 CCACCCCCTCTCCCCAGGGCAGG - Intergenic
1006881677 6:37345396-37345418 CCCCCACACCACCCCACGGCAGG + Intergenic
1006915087 6:37588683-37588705 CCTTCTCAACTCCCCAGGGAGGG - Intergenic
1006987985 6:38189518-38189540 CTCACTCTGCTGCCCAGGGCTGG + Intronic
1007038855 6:38702923-38702945 CTCCCCCAGCTCCGCTGGGCCGG - Intronic
1007495870 6:42260070-42260092 CCCCCATTGCTCCCCAGGGACGG + Intronic
1007612572 6:43160017-43160039 CCTACTCAGGGCCCCAGGGCTGG + Intronic
1007631340 6:43275177-43275199 CCCCCGCAGGTCCCCAAGCCAGG + Intronic
1007778611 6:44238048-44238070 CCCCCTCCGCTCCTCGCGGCGGG - Intergenic
1007782493 6:44262658-44262680 CCGCCTCTGCTCCCCTAGGCTGG - Exonic
1007932658 6:45706513-45706535 CCCCTTCAGATTCTCAGGGCAGG + Intergenic
1011448956 6:87472946-87472968 CCCCCTCCGCGCCCCCGCGCAGG - Intronic
1013086374 6:106861346-106861368 CCCCCTCCATTCCCCAGGACTGG + Intergenic
1013457103 6:110340207-110340229 GCCCCTCAGCAACCCAGGCCTGG - Intronic
1016447674 6:144150232-144150254 CGTCCTCTGGTCCCCAGGGCAGG - Intergenic
1016746911 6:147590658-147590680 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1016833359 6:148454198-148454220 CCTCCTCAGCTCCTCAGTCCTGG - Intronic
1017163814 6:151390360-151390382 CCCCCTCAGCCCCTCGGGGACGG - Intronic
1017307456 6:152935683-152935705 CCTCCTCAGCCTCCCAGTGCTGG + Intergenic
1017900426 6:158714650-158714672 CCTCCTAAGATGCCCAGGGCTGG + Intronic
1017908369 6:158772185-158772207 GGCCATCAGCTCCCAAGGGCAGG + Intronic
1018232895 6:161692655-161692677 CCCCCTCAGCCTCCCAGTGCTGG - Intronic
1018242885 6:161795479-161795501 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1018389631 6:163332265-163332287 CTGCCCCTGCTCCCCAGGGCAGG + Intergenic
1018896110 6:168018723-168018745 CTCCTTCAGCTACCAAGGGCTGG + Intronic
1019122201 6:169812248-169812270 CCTCCACAGGTCCCCAGGGGTGG + Intergenic
1019190450 6:170247739-170247761 CCAGCTCAGCTCCCAGGGGCTGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019343622 7:519630-519652 CGCCCTCCGCTCGCCGGGGCCGG + Intronic
1019362168 7:610439-610461 GTCCCTCATCTCCCCAGGGACGG + Intronic
1019526980 7:1484908-1484930 CCCCTTACCCTCCCCAGGGCAGG + Intronic
1019592408 7:1842353-1842375 CCACCTCAGGCCTCCAGGGCCGG - Intronic
1019696125 7:2447035-2447057 CACCCTCAGCACATCAGGGCTGG - Intergenic
1020118296 7:5488522-5488544 CGGTCTCAGCTCCGCAGGGCTGG - Intronic
1020139567 7:5605201-5605223 CACCCTCCGCTGCCCAGGGTAGG + Intronic
1020287448 7:6695452-6695474 CTGCCTCAGCTTCCCAGGGTTGG + Intronic
1021927291 7:25545832-25545854 AGCCCTCAGCTGCCCAAGGCTGG - Intergenic
1022496949 7:30859337-30859359 CTCCCTCAACTCCCTGGGGCTGG + Intronic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1023615037 7:42011227-42011249 CTGCCTAAGCTCCCCTGGGCTGG - Intronic
1023768804 7:43536365-43536387 CCCCCTCCACTGCCCAGGGGAGG + Intronic
1024168945 7:46764526-46764548 CCGCCTCAGCTTTCCAAGGCAGG + Intergenic
1024453441 7:49575977-49575999 CCCCCTCACCCCGCCAAGGCTGG - Intergenic
1024580074 7:50793702-50793724 CCCGCTCAGCAGCCCGGGGCAGG - Intergenic
1025095394 7:56092129-56092151 CCTCCTCAGCCCCCCAGGAAAGG - Intronic
1025199076 7:56950691-56950713 CACTCGCAGCCCCCCAGGGCTGG - Intergenic
1025672871 7:63626242-63626264 CACTCGCAGCCCCCCAGGGCTGG + Intergenic
1026535769 7:71237390-71237412 CCACCACATCTACCCAGGGCTGG - Intronic
1027045953 7:74991559-74991581 CCCACTCAGCAGCCCAGGCCAGG + Intronic
1027051730 7:75025222-75025244 CCCCCTCAGGTCATCGGGGCTGG + Intergenic
1028147359 7:87332782-87332804 CTGCCTCAGCTTCCCAGTGCTGG - Intergenic
1028472708 7:91222265-91222287 CCGCCTCATTTCCCCAGAGCAGG + Intergenic
1029125949 7:98295297-98295319 CCTCCCCAGATCCCCTGGGCAGG + Intronic
1029272300 7:99384565-99384587 CTCCTTCAGTTCCCCAAGGCTGG + Intronic
1029386870 7:100249012-100249034 CCCACTCAGCAGCCCAGGCCAGG - Intronic
1030047793 7:105512974-105512996 TCCTCTCAGTTCCCCAGGGATGG - Intronic
1030202378 7:106918574-106918596 ACCCCTCAGATGGCCAGGGCAGG + Intergenic
1032431821 7:131868279-131868301 CTCCTTCTTCTCCCCAGGGCTGG - Intergenic
1032532723 7:132635609-132635631 ATTCCTCAGCTCCCCAGGACGGG + Intronic
1034228784 7:149502598-149502620 GCACCTGAGCTCTCCAGGGCAGG + Intergenic
1034345638 7:150383826-150383848 CAGCCTCAGCGCCCCAGGTCGGG - Intronic
1034401173 7:150862590-150862612 CTCCCTCAGCTCCAGAGGGAGGG - Intergenic
1034438893 7:151076730-151076752 CCCCTTCAGGCCCCCAGCGCAGG + Exonic
1034449497 7:151129692-151129714 CCCCCCCACCTCCCCACCGCGGG + Intronic
1034530551 7:151693686-151693708 CCTCCTCACCTCCCAAGGCCCGG - Intronic
1034996650 7:155581521-155581543 ATGCCTCAGCTTCCCAGGGCAGG + Intergenic
1035257945 7:157643926-157643948 CACGCTCAGCTCACCAGTGCGGG + Intronic
1035262382 7:157670145-157670167 AGCCCTCACCTCCCCAGAGCAGG - Intronic
1035266396 7:157692288-157692310 ACCCCCCACCTCCCCAGGCCAGG + Intronic
1035380662 7:158438517-158438539 CCTCCGCAGCTCCCCAAAGCAGG + Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038353742 8:26806824-26806846 CACCCTCAGCTTCCCAGAGTGGG + Intronic
1039885197 8:41650363-41650385 CAAGCTCAGCCCCCCAGGGCTGG - Intronic
1039954078 8:42194163-42194185 CTGCCTCAGCTTCCCAGAGCTGG + Intronic
1040286187 8:46101606-46101628 CCCCCAGGGCTCTCCAGGGCAGG - Intergenic
1040313244 8:46247646-46247668 ACCCCTGGGCTCCCCTGGGCAGG + Intergenic
1040314135 8:46252018-46252040 CCCCCTGGGCTCCCCTGGGCAGG + Intergenic
1040324995 8:46337175-46337197 CCCCCACGGCTCTCCTGGGCAGG + Intergenic
1040915456 8:52563817-52563839 CTCCATCCCCTCCCCAGGGCAGG + Intronic
1041675775 8:60537925-60537947 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1042238811 8:66641472-66641494 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1042789179 8:72584397-72584419 TCACCTCTGCTCCTCAGGGCTGG + Intronic
1042829955 8:73016003-73016025 CCACCTCAGCCTCCCAGAGCTGG - Intronic
1043405579 8:79928795-79928817 CCCACTCAGCTCCAAAGTGCTGG - Intronic
1044811758 8:96070609-96070631 CCCCTTGAGCTTCCCAGGGAAGG - Intergenic
1046887499 8:119383675-119383697 CACTCTCAGCTCCTCAAGGCTGG - Intergenic
1046986053 8:120390339-120390361 CCACCTCAGCTCCCCCTGCCAGG + Intronic
1047318693 8:123758176-123758198 CCACCTCAGCTGCCCAGGGCTGG + Intergenic
1047338033 8:123954913-123954935 TCCCCTCCTCTCTCCAGGGCTGG + Intronic
1047728113 8:127702275-127702297 CTCCCCCATCTCCCCAGGGATGG - Intergenic
1048017852 8:130513381-130513403 CCACCTCAGCCTCCCAAGGCTGG - Intergenic
1048179544 8:132182484-132182506 CAGCCTCATCTCCCCAGGGAGGG + Intronic
1049098960 8:140565609-140565631 CTCACTCTGATCCCCAGGGCTGG - Intronic
1049190799 8:141286247-141286269 TCTCCTCAGCTCCCGAGGGAAGG - Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049230428 8:141478815-141478837 CCTCCACAGCTCCCCAGAGGAGG - Intergenic
1049247475 8:141570459-141570481 CCCCCTGACCCCCGCAGGGCCGG - Intergenic
1049292304 8:141810883-141810905 CCCCTTCAGCTCCCCACCGAGGG - Intergenic
1049305270 8:141899505-141899527 CACCCTGAGCCACCCAGGGCAGG - Intergenic
1049443289 8:142618872-142618894 CGCCCTCAGCTCCTCAGGAGAGG + Intergenic
1049635099 8:143684010-143684032 CCCGCTTAGCCCCGCAGGGCTGG + Intergenic
1049798172 8:144505831-144505853 CCTCCCCGGCACCCCAGGGCAGG + Exonic
1050382385 9:5042968-5042990 CCCCCTCAGCTTCTGAGGGTCGG - Intronic
1051418933 9:16871296-16871318 CGCCCGCAGCTCCCCGGGGGGGG - Intergenic
1051659183 9:19409638-19409660 CCCCCGCAGGTCCCCGCGGCTGG + Intronic
1052973822 9:34397873-34397895 CCTCCTCACCTTCCCAGGGATGG - Intergenic
1053571876 9:39318335-39318357 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1053797514 9:41740072-41740094 TCCCCTCCACTCCCCAGGGGTGG + Intergenic
1054093430 9:60877046-60877068 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054114913 9:61152966-61152988 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054125269 9:61300676-61300698 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054147673 9:61574871-61574893 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1054185926 9:61952124-61952146 TCCCCTCCACTCCCCAGGGGTGG + Intergenic
1054467421 9:65505918-65505940 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1054592843 9:67029568-67029590 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054652578 9:67636395-67636417 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1055530280 9:77177263-77177285 CCCCAGCGGCCCCCCAGGGCGGG - Intergenic
1056754577 9:89373711-89373733 CTCCCCCAGCCACCCAGGGCAGG - Intronic
1057440113 9:95077042-95077064 CCCCCTCTCCTCCCCAGGCCTGG - Intronic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1058396184 9:104556981-104557003 CCGCCTCCCCTCCCCAAGGCTGG + Intergenic
1058862159 9:109126975-109126997 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic
1059267324 9:113047500-113047522 CCTCCTCAGCTTCCCAGTGTTGG - Intronic
1059320617 9:113465627-113465649 CCTCCTCAGCTTCCCAGATCTGG - Intronic
1059379890 9:113914879-113914901 CCCCCTCATCTTCCCAGCACTGG + Intronic
1059425816 9:114220340-114220362 CAGACTCGGCTCCCCAGGGCAGG - Intronic
1059449709 9:114362693-114362715 CCACGGCAGCTCTCCAGGGCAGG - Intronic
1060202540 9:121659995-121660017 GCCTCTGAGCTCCCGAGGGCGGG - Intronic
1060218723 9:121753439-121753461 CCCTCTCTGCTGCCCAAGGCTGG - Intronic
1060406615 9:123376071-123376093 CCCAGCCACCTCCCCAGGGCAGG + Intronic
1060924834 9:127449072-127449094 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1060995271 9:127872222-127872244 GCCCCTGAGCTCCCCAGGGCAGG - Intronic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061389926 9:130311803-130311825 CCTCCGCAGCTCCCCAGGCGGGG - Intronic
1061404488 9:130385816-130385838 TCCCCGCAGCTCGCCAGGGCTGG - Intronic
1061786399 9:133031049-133031071 CCGCCTCAGCTCCACGGGGACGG - Exonic
1061802349 9:133119533-133119555 CTCCCTCAGTTCCTCAGGGACGG + Intronic
1062377277 9:136267845-136267867 CCCCCTCTGTCACCCAGGGCGGG + Intergenic
1062378178 9:136274360-136274382 CTGACTCAGCTCCCCAAGGCTGG + Intergenic
1062538801 9:137032434-137032456 CCCACCCAGCTACCCAGGCCTGG + Exonic
1062555574 9:137112225-137112247 GCGCCTCTCCTCCCCAGGGCTGG - Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1185583611 X:1229029-1229051 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1186349287 X:8727228-8727250 CACCCTCACCTCTCCAGGACAGG + Intronic
1187306444 X:18099257-18099279 AACCCTCAGTTCTCCAGGGCTGG - Intergenic
1188161291 X:26807040-26807062 CTGCCTCAGCTCCCGAGAGCAGG - Intergenic
1189263596 X:39696061-39696083 CCCCCTCAGCCTCCCAGTGTTGG + Intergenic
1189961885 X:46332312-46332334 CTCCCTAACCTCCCCAGGGTGGG + Intergenic
1190268612 X:48845165-48845187 CCACCTCAGCTGCCCAGTGTTGG - Intergenic
1190329329 X:49226112-49226134 CCACCTGAGCCCCCCAGGGCAGG - Intronic
1191244321 X:58213964-58213986 CCACCTCAGCCTCCCAGTGCTGG + Intergenic
1192068765 X:67914934-67914956 CCACCTCAGCTTCCCAAAGCTGG - Intergenic
1192929044 X:75785337-75785359 CCCCCTCACCTCTGAAGGGCAGG + Intergenic
1195126504 X:101813870-101813892 CCCACTCTGGTCCACAGGGCTGG - Intergenic
1195778989 X:108439907-108439929 CCCCCTCCCCTCCCCAAAGCCGG - Exonic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198210434 X:134510976-134510998 CCACCTCGGCTTCCCAGTGCTGG - Intronic
1199329624 X:146543573-146543595 CTTCCACAGATCCCCAGGGCAGG + Intergenic
1199879842 X:151965144-151965166 CCCCCCCAGCTCCCCTGAGATGG - Intronic
1200142725 X:153909919-153909941 CCCCCTCTCCTCCCCAGACCTGG - Exonic
1200232206 X:154449672-154449694 CTCCCTCAGGTCCGCAGGGGTGG + Exonic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic
1202303922 Y:23447606-23447628 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1202566888 Y:26222985-26223007 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic