ID: 954583672

View in Genome Browser
Species Human (GRCh38)
Location 3:51717304-51717326
Sequence CTGTGTAAGTGCATGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954583672 Original CRISPR CTGTGTAAGTGCATGTATGT GGG (reversed) Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900293767 1:1938104-1938126 GAATGTGAGTGCATGTATGTGGG - Intronic
900293773 1:1938270-1938292 GAGTGTGAGTGCATGTATGTGGG - Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
900952999 1:5868728-5868750 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953014 1:5868897-5868919 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953029 1:5869070-5869092 ATGTGTGGGTGCATGCATGTGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
901117450 1:6859300-6859322 TTGTGTCAGTGCCTGTGTGTGGG + Intronic
901474178 1:9478113-9478135 GTGTATATGTGTATGTATGTTGG - Intergenic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
902606124 1:17570303-17570325 CTGGGTCAGGGCATGTGTGTGGG + Intronic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
906807600 1:48794309-48794331 ATGTGTAAGTGCATATAGGAAGG - Intronic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912542263 1:110425929-110425951 CTCTGTAAGTGCTTGCAAGTGGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
914935799 1:151978927-151978949 AAGTGCAAGTGCATGTAGGTGGG + Intergenic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
920338909 1:205263126-205263148 GTGTGTACCTGCATGCATGTGGG - Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920698010 1:208196414-208196436 CTGTGTAAGTGCATGCTTAAAGG - Intronic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921847246 1:219897243-219897265 GTGTATATGTGTATGTATGTTGG - Intronic
923377946 1:233384655-233384677 GTATGTGTGTGCATGTATGTTGG + Exonic
1062778561 10:178504-178526 CTGTTTAAGTGCACTTGTGTTGG - Intronic
1062993417 10:1842324-1842346 ACATGTATGTGCATGTATGTGGG - Intergenic
1063257245 10:4341802-4341824 ATGTGTACATGCATGTGTGTGGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1064364428 10:14694315-14694337 CTGTGGAAGGGAATGTAGGTTGG - Intronic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066544625 10:36486239-36486261 ATGTGTAAGTGCATATAATTTGG - Intergenic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068865621 10:61892596-61892618 CTATATCAGTGCATGTATCTGGG - Intergenic
1069289707 10:66763039-66763061 GAGTGTATGTGCATGTCTGTGGG + Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071458899 10:85872831-85872853 CTGGGTCAGAGCATGTATGCTGG + Intronic
1071785104 10:88890604-88890626 TTGTGTAAGTGATTGGATGTTGG + Intronic
1072621615 10:97083407-97083429 TTCTGGAAGTGTATGTATGTCGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073493554 10:103871611-103871633 TTGTGTATGTGTATGTTTGTAGG - Intergenic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074412048 10:113236667-113236689 CTGGGTCAGAGCATGTTTGTGGG + Intergenic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075650494 10:124125314-124125336 GGATGTGAGTGCATGTATGTGGG - Intergenic
1075913115 10:126142857-126142879 GTGTGTATGTGTGTGTATGTGGG + Intronic
1076403180 10:130196445-130196467 ATGTGTGCATGCATGTATGTGGG + Intergenic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076919273 10:133442867-133442889 CTGTGTGAGAGCATCTCTGTAGG - Intergenic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078039405 11:7844701-7844723 CTGTGCAAGTGCAGTCATGTGGG + Intergenic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078604406 11:12762513-12762535 CTGTGTAAATGTACATATGTTGG + Intronic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079567956 11:21906041-21906063 ATGTGTATGTGTATTTATGTGGG - Intergenic
1079784207 11:24650389-24650411 GTGTGTTGTTGCATGTATGTTGG - Intronic
1081351161 11:42054079-42054101 ATGTGTGCGTGCATGTGTGTTGG - Intergenic
1081475891 11:43430698-43430720 GTGTGTGTGTGCGTGTATGTAGG - Intronic
1081689427 11:45067243-45067265 ATGAGTAAGTTCATGCATGTGGG - Intergenic
1081960291 11:47131055-47131077 TTGTGTGAGTGCCTATATGTTGG - Intronic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1082727030 11:56748409-56748431 CTGTGTGAGTGAATATATGATGG + Intergenic
1083256231 11:61497229-61497251 GTGTGTAAGTGTATATGTGTGGG + Intergenic
1083256252 11:61497806-61497828 ATGTGTGAGTGTATGTGTGTGGG + Intergenic
1084009940 11:66341963-66341985 CTGTGTATGTGCTTGTGTGTAGG + Intronic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085219390 11:74860675-74860697 CTGCAAAAGGGCATGTATGTGGG - Intronic
1085433593 11:76479400-76479422 CTGTGGAAGTGCTTGTGTGAGGG - Intronic
1086321647 11:85654420-85654442 CTGTGTATGTGCATCTTGGTTGG - Intronic
1086858446 11:91895843-91895865 TTATATATGTGCATGTATGTAGG - Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087570389 11:99919992-99920014 CTATGTATGTGCACGTCTGTGGG + Intronic
1087964029 11:104390347-104390369 GTGTGTGAGTGTGTGTATGTAGG + Intergenic
1089110157 11:116049192-116049214 ATGTGTAAGTGTATGTTTGTAGG - Intergenic
1089750048 11:120645143-120645165 GTGTGTATGTGTATGTATGGTGG + Intronic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1092229341 12:6767993-6768015 CTGTGTCTGTGCATGGCTGTCGG + Intronic
1093261887 12:16949260-16949282 GTATGTAAGTGCATGTATAGGGG - Intergenic
1093545653 12:20343290-20343312 CTGTGTATGTGCATATGTGTTGG - Intergenic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1094635133 12:32219264-32219286 GTGTGTGCGTGCATATATGTTGG + Intronic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1101915865 12:108895443-108895465 CGGTGTGTGTGCACGTATGTGGG + Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107333281 13:39325182-39325204 GTGTGTACCTGCATGTCTGTGGG - Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1107807260 13:44165202-44165224 CTGTGTAAGTGTATGTGTTGGGG - Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108242313 13:48478504-48478526 CTTTTTAAGTGCATATTTGTGGG - Intronic
1108563848 13:51674715-51674737 GTGTGTATGTGTCTGTATGTGGG + Intronic
1108789651 13:53952210-53952232 GTGTGTGTTTGCATGTATGTTGG - Intergenic
1109229321 13:59737596-59737618 CTTTATAAGTCCACGTATGTTGG - Intronic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110394061 13:75009630-75009652 GGGTGTATGTGCATGCATGTGGG - Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1111356410 13:87109636-87109658 CTGTGTTTGTGTGTGTATGTGGG + Intergenic
1111409497 13:87855585-87855607 CTATATAAGTGTATGTATATGGG + Intergenic
1111644280 13:91010555-91010577 GTGTGTAAGTGCACGTGTATAGG - Intergenic
1112458790 13:99584849-99584871 CTGTGAAAGTGCATGCATGGAGG + Intergenic
1113870585 13:113557375-113557397 AGGTGTGTGTGCATGTATGTAGG + Intergenic
1113896097 13:113765467-113765489 ATGTGTAAGTGCGTGTGTGCAGG - Intronic
1115153530 14:30313004-30313026 GTGTGTGTGTGCATGCATGTTGG - Intergenic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1119106508 14:71930417-71930439 ATATGTATGTGTATGTATGTGGG - Intergenic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1120085843 14:80271833-80271855 ATGTGAAAGAGCATGTCTGTTGG - Intronic
1121298419 14:92849457-92849479 TTGTGAATGTGTATGTATGTAGG + Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1122088222 14:99321424-99321446 GGGTGTGAGTGCATGTGTGTGGG - Intergenic
1122999368 14:105284148-105284170 TTGTGGACGTGCATGTGTGTTGG - Intronic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125446067 15:39758317-39758339 CTCTGTAAGTGGATCTATGGTGG - Intronic
1126794348 15:52247807-52247829 GTGTGTAAATGTCTGTATGTGGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1129156418 15:73721169-73721191 CTGTGTAAGTGCAGGTGAGGTGG - Intergenic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130425641 15:83795669-83795691 ATTTGGAAGTGCATGTATATTGG + Intronic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG + Intergenic
1133266698 16:4589108-4589130 CTGCGTAAGTGCAGGGATGTGGG - Intronic
1133706094 16:8356073-8356095 CTGTGCCAGTGCTTGTATTTTGG - Intergenic
1134176624 16:12012261-12012283 ATGTGAAAGTGCAGGGATGTGGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1135897971 16:26427187-26427209 ATGTGTATGTGCATATATATGGG + Intergenic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1137720317 16:50623862-50623884 GTGTGTAGGGGTATGTATGTAGG + Intronic
1138959535 16:62012010-62012032 GTGTGTATGTGCATGCAGGTGGG + Intronic
1139429952 16:66905637-66905659 GTGTGTAAGTGCGGGGATGTAGG + Intergenic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1140957498 16:79878859-79878881 CTGGGTAAGAGCAGGTATGCAGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141710903 16:85698437-85698459 TTGTGCAAATGCATGAATGTGGG - Intronic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142639130 17:1275418-1275440 GTGTGTGAGTGAATGTGTGTGGG + Intergenic
1143845633 17:9771198-9771220 CAGTGTGAGTGTGTGTATGTGGG + Intergenic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144507713 17:15846860-15846882 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1144672073 17:17138463-17138485 GGGTGGAAGTGCATGTGTGTGGG - Intronic
1145171837 17:20664477-20664499 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1146446985 17:32939966-32939988 CTGTGTATGCGCATGTCTGGTGG - Intronic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1146733021 17:35212150-35212172 CTGTGTATGAGCAAGTGTGTTGG + Intergenic
1147212829 17:38882032-38882054 GTGTGTAACTGCACGCATGTGGG - Intronic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1148855619 17:50577778-50577800 GTGTGCAAGTGCACGTGTGTGGG + Intronic
1149684177 17:58526052-58526074 CTGTGAGAGTGTATGTATGTGGG - Intronic
1151035008 17:70788783-70788805 ATGTGGAAGTGCATGTGAGTTGG + Intergenic
1151206443 17:72511583-72511605 GTGTGTAAGTGTACGTATGTGGG + Intergenic
1151411844 17:73935905-73935927 GTGTATAAGTGAATGCATGTGGG - Intergenic
1151497148 17:74465288-74465310 TTGTGTGAGTGTATGTGTGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153659961 18:7317607-7317629 GTGTGAAAGTGAGTGTATGTGGG + Intergenic
1154351866 18:13590053-13590075 GTGTGTGACTGCATGTGTGTGGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155767933 18:29659150-29659172 GTGTGTATGTGTATGTATGGGGG + Intergenic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1156435168 18:37119122-37119144 CTCTGTAAGTCCATGGATGGTGG + Intronic
1156499436 18:37547849-37547871 CTGTGTGAGGGTATGTATCTGGG + Intronic
1157069296 18:44387133-44387155 CTGTGTACATGTATGTATGTTGG - Intergenic
1157498813 18:48175499-48175521 CAGTGTATGTGCATGTGTATGGG + Intronic
1157562163 18:48655888-48655910 CTGTGCAAGTGCATATGTGGGGG - Intronic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1160353221 18:78203118-78203140 ATGTGCACGTGCATGTATTTTGG + Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162970192 19:14176460-14176482 CTGTGTGAGTGATTGTGTGTGGG - Intronic
1163164155 19:15483858-15483880 GTGTGTGAGTGCCTGAATGTGGG - Intronic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1166963603 19:46514677-46514699 CTGTGTAAGTCTGTGTGTGTAGG - Intronic
925329288 2:3045908-3045930 ATGTGTACGTGTGTGTATGTAGG + Intergenic
925536527 2:4924103-4924125 CTATGTGAGTGTATGAATGTAGG + Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925788318 2:7454657-7454679 GTGTGTAGGTGTCTGTATGTGGG + Intergenic
925788324 2:7454727-7454749 GTGTGTAGGTGTCTGTATGTGGG + Intergenic
925802060 2:7611114-7611136 CTGTGTGTGGGCATGCATGTGGG + Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926555024 2:14347573-14347595 GTGTGTATGTGTGTGTATGTGGG - Intergenic
926591708 2:14747229-14747251 CTGTATGAGAGTATGTATGTGGG - Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
927367583 2:22317320-22317342 GTGTGTACGTGTGTGTATGTGGG + Intergenic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928135054 2:28681809-28681831 TTATGTATGTGTATGTATGTAGG - Intergenic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928171312 2:29005364-29005386 GTGAGAACGTGCATGTATGTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929369474 2:41204848-41204870 GTGTGTACGTGCGTGTATGTGGG + Intergenic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932224748 2:70030712-70030734 CTCTGTATGTGTATGTGTGTTGG + Intergenic
932852842 2:75203097-75203119 CTGTGTATGTGCAAATATATGGG - Intergenic
933320495 2:80770395-80770417 CTATGTATGTGCGTGTGTGTGGG - Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
934946450 2:98546022-98546044 CTTTGTATGTGCAAGTTTGTGGG - Exonic
935715602 2:105936514-105936536 CTGTGTAGATGTATGCATGTTGG - Intergenic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
936500329 2:113061610-113061632 ATGTGTGAGTGCAGGTATGTAGG + Intronic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
936759836 2:115763747-115763769 TTGTGGAAGTGCAAGTATGAGGG - Intronic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937817392 2:126266859-126266881 TTGTGTATGTGCGTGTGTGTTGG - Intergenic
939685482 2:145193843-145193865 CCGTGTGAGTGTATGTGTGTGGG - Intergenic
940408420 2:153332459-153332481 CTGTGTAATTGCTTGTTTATGGG + Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
946126834 2:217570065-217570087 CTGTTGAAGTGCATTTGTGTTGG - Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946707940 2:222477559-222477581 ATGTGTGAGTGTATGTATATAGG + Intronic
948354225 2:237364899-237364921 GTGTGTGGGTGCATGTCTGTGGG + Intronic
1171030387 20:21671218-21671240 CTGTATATGTGCATGTGTGTGGG - Intergenic
1171098660 20:22359608-22359630 GTGTGTGTGTGCATGTATGGTGG - Intergenic
1171104862 20:22422929-22422951 GTGTGTGTGTGCTTGTATGTAGG - Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1171533227 20:25865754-25865776 CTGTGCCAGTGCTTGTGTGTCGG - Intronic
1173164770 20:40679847-40679869 ATGTTTGTGTGCATGTATGTGGG + Intergenic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1177502738 21:21979658-21979680 GTCTGTACGTGTATGTATGTTGG + Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179393209 21:41012572-41012594 GTGTGTGAGTGAATGTGTGTGGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179982653 21:44904367-44904389 TTGTGTGTGTGCATATATGTGGG - Intronic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1180917962 22:19502501-19502523 CTTTGTATGTGTGTGTATGTGGG - Intronic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181768779 22:25111215-25111237 GTGTGTGTGTGCGTGTATGTCGG - Intronic
1182376753 22:29854090-29854112 CTGTTTAAGTCCATTTATGGTGG - Intergenic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183062155 22:35342802-35342824 CTGTGTAGGTGTATGAGTGTAGG - Intronic
1183062325 22:35344034-35344056 GTGTGTAAGGGTGTGTATGTAGG - Intronic
1183540173 22:38425222-38425244 GTGTGGATCTGCATGTATGTAGG + Intergenic
1183614860 22:38937806-38937828 GTGTGTGAGTGTGTGTATGTGGG + Intergenic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949497438 3:4645847-4645869 GTGTGTAGGTGTGTGTATGTGGG - Intronic
949715502 3:6926069-6926091 GGGTGTACGTGCATGTGTGTGGG - Intronic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
954413972 3:50383900-50383922 CTGTGTGCGTGCATTTGTGTGGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
954966620 3:54617158-54617180 ATGTGGAAGTGCATGTGTTTTGG + Intronic
955011218 3:55016561-55016583 CTGTGTGCATGCATGTAGGTGGG + Intronic
955883945 3:63577607-63577629 GTGTGTAGGTGTATGAATGTAGG + Intronic
956413497 3:69003123-69003145 TTGTGTAGGTGCGGGTATGTAGG - Intronic
957422487 3:79989402-79989424 CTTTGTGTGTGCATGTAGGTAGG - Intergenic
957764247 3:84601065-84601087 GTGTGTGTGTGCGTGTATGTGGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959921294 3:111871253-111871275 CTGGATAATTGCATTTATGTAGG + Intronic
960775940 3:121253471-121253493 TTATGTAAGTGAATGTTTGTAGG - Intronic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963712698 3:148765696-148765718 ATGATTAAGTGCATGTCTGTTGG - Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
965185836 3:165461987-165462009 CTGTCAAAGGACATGTATGTGGG + Intergenic
965440892 3:168712698-168712720 CTCTGTAAGTGTCTGTGTGTGGG - Intergenic
965519256 3:169657013-169657035 CTGTGTATGTCCTTGTAAGTTGG - Intronic
966035585 3:175410563-175410585 CTCTGTAAGAGCAAGGATGTTGG - Intronic
967090993 3:186134682-186134704 CTGTGTCAGTGTATGTGTATGGG + Intronic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969193746 4:5544417-5544439 TTGTGTGCGTGCATGTGTGTGGG - Intronic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969514668 4:7639997-7640019 GTGTGAAAGTGCATGTCTGTGGG + Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
970425752 4:15944820-15944842 TTTCTTAAGTGCATGTATGTGGG - Intergenic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
971766021 4:30833111-30833133 TTGTGTGTGTGCATGCATGTGGG + Intronic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973998600 4:56485959-56485981 ATGTATAGGAGCATGTATGTAGG + Intronic
974138960 4:57858824-57858846 GTGTGTATGTGTGTGTATGTAGG - Intergenic
974165515 4:58196337-58196359 TTGTGTATGTGTGTGTATGTAGG + Intergenic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977892206 4:102325368-102325390 ATGTGAGAGTGCATGTGTGTTGG - Intronic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
981284946 4:143005724-143005746 ATGTGTATGTGCATGAAAGTAGG - Intergenic
982776442 4:159446352-159446374 GTGTGTAAATGCATCTGTGTAGG + Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984671054 4:182488024-182488046 ATGAGGAAGTGCATGTATTTTGG + Intronic
984963452 4:185120496-185120518 GTGTGTATGTGGGTGTATGTAGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
985833786 5:2256220-2256242 CTCTGTATGTGCATGCATATGGG + Intergenic
986162169 5:5239979-5240001 CTGTGTAAGTTAATGGCTGTTGG + Intronic
987655793 5:20804238-20804260 GTGTGTGCGTGCATGTATGTAGG + Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988767761 5:34399670-34399692 GTGTGTGCGTGCATGTATGTAGG - Intergenic
988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG + Intronic
988934759 5:36070906-36070928 CTGCTTAAGTGCATGAATATAGG + Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
994131056 5:96227887-96227909 ATGTGTAAGGGCAAGTATGGTGG + Intergenic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
995416162 5:111915671-111915693 ATGTGTAGGTGCATGTGTGAGGG - Intronic
995755827 5:115502996-115503018 CAGTGTAAGGGGATGTAGGTAGG - Intergenic
996228430 5:121031164-121031186 CTGTGTGAGAGCATGTCTTTGGG - Intergenic
996249480 5:121311322-121311344 CTATGTGTGTGTATGTATGTGGG + Intergenic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996868732 5:128160863-128160885 GTGTGAGAGTGCGTGTATGTAGG + Intronic
997170425 5:131713696-131713718 CTGTTTAATTGCATGTATATTGG - Intronic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997623572 5:135316647-135316669 CTGTGTGAGTGCATGCACGATGG + Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
997755244 5:136390176-136390198 CTGTGTAGTTGCATTTATATTGG + Intronic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998715329 5:144877145-144877167 TTGTGTATGTGTGTGTATGTAGG + Intergenic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999456605 5:151721659-151721681 CTCTGTAAGCTCATATATGTGGG + Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001567302 5:172707793-172707815 CAGTGTTAGTGTATGAATGTAGG + Intergenic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004123705 6:12851594-12851616 CTGTGTAATTACATATATGCCGG - Intronic
1004127047 6:12883971-12883993 TTGTGTATGTGTGTGTATGTGGG - Intronic
1004127051 6:12884065-12884087 TTGTGTATGTGTGTGTATGTGGG - Intronic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1007355197 6:41309985-41310007 CTATGTGTGTGCGTGTATGTGGG + Intergenic
1011379489 6:86727211-86727233 GTATGTATGTGCATGTATTTAGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012136985 6:95570602-95570624 CAGTGTAAGAGTATGTGTGTGGG - Intergenic
1012517651 6:100081375-100081397 TTGTATTTGTGCATGTATGTGGG + Intergenic
1013895363 6:115081588-115081610 GTGTGTGGGTGTATGTATGTAGG + Intergenic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1014975149 6:127871284-127871306 ATGTGTATGTGTATGTATATAGG - Intronic
1016453603 6:144209391-144209413 CTGTGTACGTTCATGCAAGTGGG + Intergenic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1019075050 6:169380199-169380221 GTGTGTATGCGTATGTATGTAGG + Intergenic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019553863 7:1618984-1619006 GTGTGTAGGTGTGTGTATGTGGG + Intergenic
1019553915 7:1619308-1619330 GTGTGTAGGTGTATGTGTGTCGG + Intergenic
1019934992 7:4249048-4249070 CTGTGTATGTGTTTGTATTTAGG - Intronic
1020017129 7:4837660-4837682 GTGTGTGGGTGCATGTGTGTTGG - Intronic
1020859986 7:13479854-13479876 CTGTTTAAATGCATATATTTTGG - Intergenic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG + Exonic
1024385084 7:48741813-48741835 CTGTGTGAGTGGATTTTTGTTGG + Intergenic
1024745991 7:52406999-52407021 CTGTGTAATTGCATTTCTGAAGG + Intergenic
1024912336 7:54459442-54459464 CTGGGTTAGTGCATGGAAGTCGG - Intergenic
1026975689 7:74496594-74496616 GTGTGGGTGTGCATGTATGTGGG + Intronic
1027618008 7:80448018-80448040 GTATGTATGTGTATGTATGTAGG - Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1029275352 7:99400695-99400717 CTGTGTGAGTGCTTGCAAGTCGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031827366 7:126582809-126582831 CTTTGTAGTTTCATGTATGTTGG + Intronic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1033088447 7:138363721-138363743 CCGAGTAAGTGCATTTATGATGG - Intergenic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG + Intergenic
1034480072 7:151313016-151313038 GAGTGTCAGTGCATGTGTGTGGG + Intergenic
1034480095 7:151313218-151313240 GTATGTCAGTGCATGTATGTGGG + Intergenic
1034480152 7:151313671-151313693 GTGTGTGAGTGCATGTGTATGGG + Intergenic
1034526872 7:151670173-151670195 ATATGTGAGTGCATGTGTGTGGG - Intronic
1034937154 7:155207664-155207686 GTGTGGGAGTGCATGTGTGTGGG + Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035019698 7:155793655-155793677 GTGTGTGAATGCATGTGTGTGGG - Intergenic
1035030880 7:155858385-155858407 CTGTGTGAGTGTAAATATGTGGG + Intergenic
1036110515 8:5895526-5895548 CTATGTCAGTGCAGATATGTTGG - Intergenic
1037080368 8:14777710-14777732 AAGTGTTAATGCATGTATGTGGG + Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1037740565 8:21605732-21605754 GGGTGTGAGTGTATGTATGTGGG - Intergenic
1038126358 8:24677550-24677572 CTGTGTATGTGTTTGTGTGTTGG - Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1042523520 8:69740513-69740535 CTGTGTGTGTGTTTGTATGTGGG + Intronic
1042840784 8:73121350-73121372 GTGTGTGAGGGCATGAATGTGGG + Intronic
1043943608 8:86225116-86225138 TTGTTTAAGTTAATGTATGTGGG + Intronic
1043986838 8:86703545-86703567 CAGTGTGAGTGCATGTTTATGGG + Intronic
1045559924 8:103251373-103251395 GTGAGTAAGAGCATGTGTGTTGG - Intergenic
1045744677 8:105404658-105404680 AAGTGTATGTGTATGTATGTTGG - Intronic
1046273692 8:111928821-111928843 CTGTGTAAGTGTATTTATCCTGG - Intergenic
1046596781 8:116270681-116270703 CTGTGTAGGTGCTTCTGTGTTGG + Intergenic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1046884723 8:119353134-119353156 TTGTGTGTGTGCATGCATGTGGG + Intergenic
1046967886 8:120187684-120187706 CTATGAAAGTGCATTTATTTGGG + Intronic
1047544957 8:125806848-125806870 CTCTGTGTGTGCATGTTTGTGGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1051781679 9:20695533-20695555 CTGTGTACGTGTATAAATGTAGG - Intronic
1052440185 9:28486555-28486577 GTGTGTGCATGCATGTATGTGGG + Intronic
1052445973 9:28561845-28561867 CTGTGTAAAGGTATGTCTGTAGG - Intronic
1052835874 9:33249551-33249573 TTGTGTGAGTGCATGTGTGCAGG - Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1058273898 9:103012968-103012990 CTTTGAAAGTGCATTTCTGTTGG + Intronic
1058661206 9:107271024-107271046 CTGTGTAAGTTCAGGTACCTGGG - Intergenic
1059350018 9:113657972-113657994 GCATGTACGTGCATGTATGTGGG - Intergenic
1059553759 9:115257233-115257255 GTGTGTCTGTGCATGTTTGTGGG - Intronic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060174247 9:121485818-121485840 CTGAGGAAGTGGGTGTATGTGGG - Intergenic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061245516 9:129399505-129399527 GTGTGCATGTGCATGTCTGTGGG - Intergenic
1061526125 9:131164256-131164278 GTGTGTAAGTGTGTGTGTGTTGG + Intronic
1061887561 9:133600199-133600221 CTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1062561099 9:137142272-137142294 GTGTGGACGTGCATGAATGTGGG - Intronic
1185615089 X:1416276-1416298 CTGTGTGCGTGCCTGTCTGTTGG - Intronic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185939557 X:4300449-4300471 CTATCTAAGTGCATCTTTGTAGG + Intergenic
1186564613 X:10649207-10649229 CTAAGTAGGTGCATGTAAGTGGG + Intronic
1186761398 X:12726606-12726628 CTTTGGTAGTGGATGTATGTGGG + Intergenic
1187441444 X:19324166-19324188 ATGTGTGAGTGCATATGTGTTGG - Intergenic
1187484419 X:19688640-19688662 TTGTGTGTGTGCGTGTATGTGGG - Intronic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189363856 X:40373313-40373335 GTGTGTATGTGCGTGTATATAGG + Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193893121 X:87076355-87076377 CTGCATAAGTGAATGAATGTTGG + Intergenic
1194620554 X:96165533-96165555 ATGTGTAAGTTGATGTAGGTAGG - Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195320911 X:103721419-103721441 ATATGTGTGTGCATGTATGTGGG - Intronic
1195464258 X:105162670-105162692 CTGTGTAACACCATGTATGGAGG + Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1196874788 X:120147451-120147473 CTGTGTATGTGTGTGAATGTGGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200490606 Y:3818344-3818366 CTGTGTCAGTGCATGTGAGATGG - Intergenic
1200816465 Y:7538288-7538310 CTGTGTTAGAGGATGTTTGTAGG + Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic