ID: 954590145

View in Genome Browser
Species Human (GRCh38)
Location 3:51776101-51776123
Sequence GGGGACACCATGTCATCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954590134_954590145 24 Left 954590134 3:51776054-51776076 CCAATGCAATTCTTTATTTATGG No data
Right 954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954590145 Original CRISPR GGGGACACCATGTCATCTGA GGG Intergenic
901384937 1:8901843-8901865 GGATCCACCATGTCATCTGGAGG + Intergenic
903564893 1:24257859-24257881 CTGGACACCTTGTCAGCTGATGG + Intergenic
905414708 1:37795790-37795812 GCGGGCACCAGGTCATCTGAGGG - Exonic
907583307 1:55591656-55591678 GAGGACACCATGTGACATGAAGG - Intergenic
907628327 1:56054051-56054073 GGGTACACCTTGTGATTTGAGGG + Intergenic
915647546 1:157284505-157284527 GGGAACACCATGTCCTCATATGG + Intergenic
915663083 1:157419862-157419884 GGGAACACCATGTCCTCAGATGG - Intergenic
917241514 1:172953951-172953973 GGGGACATGAAGTCATCTCAAGG - Intergenic
921121081 1:212138391-212138413 GGGGACACAGTGTCATATCATGG - Intergenic
1063595806 10:7434659-7434681 GAAGACACCAGCTCATCTGATGG - Intergenic
1064048013 10:12036217-12036239 GGGGTCACCATGTGCTCTGTAGG + Intronic
1064559919 10:16585850-16585872 GGAGAGACCATGTCCTGTGATGG - Intergenic
1071955259 10:90750986-90751008 GGGGAAATCATGTCAGATGAAGG + Intronic
1072442351 10:95468285-95468307 AGGGTCACCATGGGATCTGAGGG - Intronic
1072533498 10:96341682-96341704 GGACAGACCATGGCATCTGAAGG + Intergenic
1077781388 11:5333711-5333733 GGGGTCACCATGACACCTGTAGG - Intronic
1081345622 11:41982129-41982151 GGAGACACAATGTCATCTAGTGG + Intergenic
1082142118 11:48621309-48621331 GGGGCTACCATCTCATTTGAAGG + Intergenic
1082618469 11:55392266-55392288 GGGGCTACCATCTCATATGAAGG + Intergenic
1084270291 11:68025872-68025894 GAGGCCACCATGTCAGCTGAAGG - Intronic
1086575650 11:88336786-88336808 GGGGTAACCATGTTATCTGAAGG + Intronic
1089189882 11:116646004-116646026 GGGGCTCCCATCTCATCTGAAGG - Intergenic
1089593227 11:119558543-119558565 GGGGACACTTTGTGAACTGATGG + Intergenic
1089798970 11:121007938-121007960 GGAGACACAAAGTCATCTTAAGG + Intergenic
1089920683 11:122206819-122206841 GGAGACACCAAGTCTTATGATGG - Intergenic
1090025602 11:123165184-123165206 GGGGATGCCTTGTCATCAGAGGG - Intronic
1090759162 11:129820602-129820624 GGGCACGCCAGGTCATCTGAGGG + Intronic
1101098918 12:101372152-101372174 GGGGATACCGTTTCTTCTGAAGG - Intronic
1102150307 12:110685149-110685171 GTGGACCCAATGTCATCAGAGGG + Intronic
1102775739 12:115517188-115517210 GAGGACACAGTGTCATCTGGAGG + Intergenic
1102952430 12:117039794-117039816 GGGGCCACCATGTGATCTTTGGG - Intronic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1105858390 13:24390436-24390458 GGGGAGTCCGTGTCATCTGAAGG - Intergenic
1106353290 13:28955656-28955678 AGGGAGACAATGGCATCTGAAGG - Intronic
1106754515 13:32809472-32809494 GTGGACCCAATGTAATCTGAAGG - Intergenic
1107561411 13:41560447-41560469 GAGGACACCAAGGCATCTTATGG + Intergenic
1107979755 13:45723343-45723365 GGGGCCCCCTTGTCATCTGTTGG - Intergenic
1109275474 13:60299029-60299051 GGGGAAAACATGTCATACGAGGG - Intergenic
1110123640 13:71913789-71913811 GGGGACACCACTCCATCTGTAGG + Intergenic
1111355483 13:87095729-87095751 GTGGACAACAGCTCATCTGAAGG + Intergenic
1112762673 13:102709048-102709070 GGGGAAACCATGTGCTCTAAAGG - Intergenic
1113477339 13:110593601-110593623 TGGAACAGAATGTCATCTGAAGG + Intergenic
1118672493 14:68144417-68144439 GGGAACACCATGTACTATGAAGG + Intronic
1119266861 14:73267878-73267900 GGGGACACTATGTCAGCATAGGG - Intronic
1121253919 14:92517906-92517928 TAGGACAGCATGTCACCTGAGGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1124862672 15:33458259-33458281 GGGGGCATCATCCCATCTGAAGG + Intronic
1126964731 15:54039089-54039111 GGGGGCACAATGTCTTCTAAAGG - Intronic
1127766454 15:62189983-62190005 GGGGACAACAAGTCATGGGAAGG + Intergenic
1128636860 15:69308094-69308116 GGGCCCTCCAGGTCATCTGATGG - Intronic
1131072169 15:89472772-89472794 GGGGACACCATGGGTACTGAGGG + Exonic
1132594082 16:740414-740436 GGGGACCCCACCTCATTTGAGGG - Intronic
1136393120 16:29977764-29977786 GGGGCCACCATGCCAGCTGGGGG + Exonic
1141644827 16:85361766-85361788 GGGGAGACCAAGGCAGCTGACGG - Intergenic
1147119960 17:38330111-38330133 AGGGACTCCTTGTCATCGGAGGG + Exonic
1152139221 17:78526423-78526445 GGGGACACCATGTGGTCTGGGGG + Intronic
1152766807 17:82145835-82145857 GGGCCCACCATGTCACCTGCTGG + Exonic
1153232326 18:2950724-2950746 TTGGACACCATGTCATCTCTGGG - Intronic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1156291650 18:35753060-35753082 GAGGACTCTGTGTCATCTGAGGG - Intergenic
1157171287 18:45408471-45408493 AGACACACCATGTCATCTCATGG - Intronic
1158495504 18:57951752-57951774 GGGGAAAGGGTGTCATCTGAAGG - Intergenic
1158549900 18:58426866-58426888 TGGGACACCATGTCATGTCATGG - Intergenic
1160812394 19:1018418-1018440 GGGGACTCCATGCCAGCTCAGGG + Intronic
1160893572 19:1392422-1392444 GGGGACAGCATTTCATTTGGGGG - Intronic
1164283170 19:23787151-23787173 GATGTCACAATGTCATCTGAAGG - Intronic
1165471858 19:36008694-36008716 GGGGACACAAAGTCAGGTGAGGG + Exonic
1167524164 19:49973265-49973287 GGGGCTACCATGTCATCAGAGGG - Intergenic
929404869 2:41630141-41630163 CAGGAAACGATGTCATCTGATGG + Intergenic
930021053 2:47002544-47002566 GGGTACACCATGTGGCCTGAGGG + Intronic
933018574 2:77162588-77162610 AGGGACACCAGGCCATATGAGGG - Intronic
936748276 2:115608034-115608056 AGAGACACCAAGTCAGCTGAGGG + Intronic
937231427 2:120400264-120400286 GTGGACACCATGCCAGCAGATGG - Intergenic
938101691 2:128501880-128501902 GGGGCCACCAGGACACCTGAGGG - Intergenic
938912537 2:135898693-135898715 GCAGGCACCAGGTCATCTGAGGG + Intergenic
940766084 2:157790946-157790968 GCGGTCACCATGTCATGAGACGG - Intronic
943795403 2:191986798-191986820 AGTGACACCATGTCAGCTCACGG - Intronic
948006931 2:234617324-234617346 GGCAACACCTTGTCATCGGAAGG + Intergenic
1172414142 20:34750328-34750350 GGGCCCACCATCTCAGCTGATGG - Exonic
1174846581 20:53948845-53948867 GGGGACAACAGGTGAGCTGAGGG - Intronic
1175677726 20:60961170-60961192 GGAGCCTCCATGTCATCAGAGGG + Intergenic
1180073687 21:45451055-45451077 GGGGACAGCAGGTCCTCTGGGGG + Intronic
1184998211 22:48226056-48226078 GGAGATGCCCTGTCATCTGAAGG + Intergenic
1185082774 22:48718880-48718902 GGGGCCACCTTGTCACATGAAGG - Intronic
951535061 3:23733146-23733168 GGGCACAGCATGGCATATGAGGG + Intergenic
954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG + Intergenic
954751446 3:52816471-52816493 GGGGGCACTGTATCATCTGACGG + Intronic
961844915 3:129754252-129754274 AGGGACACCATGTCATTTACTGG + Intronic
962101307 3:132345726-132345748 CAGGACACCCTGTCATATGAAGG + Intronic
962723918 3:138203420-138203442 GGAGTCACAGTGTCATCTGAAGG + Intronic
962921876 3:139957718-139957740 GGGGAAATGATGTCAGCTGATGG + Intronic
963158073 3:142120703-142120725 GTGGAGACCATGGCAGCTGAAGG + Intronic
966804739 3:183798188-183798210 GGGAATACCATGACAGCTGAAGG - Intronic
967161717 3:186744934-186744956 CATTACACCATGTCATCTGAAGG + Intergenic
974440544 4:61910567-61910589 AGGGAACCCATGTCATTTGAAGG - Intronic
984938177 4:184908056-184908078 GAGGACATAATGTCCTCTGAAGG - Intergenic
991575018 5:68093590-68093612 GGGGACACCAGTTCTCCTGACGG + Intergenic
999638662 5:153648984-153649006 GGGGACACAATGTAATCACAAGG + Intronic
1000075011 5:157776828-157776850 GGGGTCAACCTCTCATCTGAGGG - Intergenic
1003821900 6:9907327-9907349 GGGGACCCCATGTTAGCTGTGGG + Intronic
1007221846 6:40284877-40284899 GGGGATATCATATCACCTGAGGG + Intergenic
1007664861 6:43508213-43508235 CGGGTTACCATGTCAACTGATGG + Intronic
1010089275 6:71960950-71960972 GGGGTCACTATGTCTTCTGCAGG - Intronic
1012960937 6:105621016-105621038 GGGGACAGGATTTTATCTGAGGG - Intergenic
1017099471 6:150834926-150834948 GGAGTCATCATGTCAACTGACGG - Intronic
1018058697 6:160073029-160073051 GGGGACACATGGTCATGTGATGG + Intronic
1024144712 7:46501683-46501705 GGGAAAAGCATGTCATTTGAAGG - Intergenic
1026337037 7:69403337-69403359 GGGGACACCATGTGGTGTGTGGG + Intergenic
1030098580 7:105923746-105923768 GAGGAAACCATGTCTTCTCAGGG - Intronic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1036205761 8:6804651-6804673 GGGGTCTGCATGTCATCTAATGG - Intergenic
1042274087 8:66985302-66985324 TTGGACTCCATGTCTTCTGATGG + Intronic
1044400029 8:91759653-91759675 GTAGACTCCATGTCTTCTGAGGG - Intergenic
1044855301 8:96469051-96469073 TAGGACACAATGACATCTGAAGG - Intergenic
1046967755 8:120186096-120186118 GGGGACAACATGGCTTCTCATGG + Intronic
1048275580 8:133063245-133063267 GGGGGCACCCTGGCATCTGGAGG - Intronic
1048765737 8:137842520-137842542 GGAGAAACTATTTCATCTGAGGG + Intergenic
1049407742 8:142459217-142459239 GGGGAAATCAAGGCATCTGACGG + Intronic
1051829766 9:21262791-21262813 GTGGGCACCATGTGATCTGCTGG + Intergenic
1052896832 9:33755118-33755140 GGGCACGCCAGGTCATCTGAGGG + Intronic
1053003799 9:34591550-34591572 AGGGACACCAGGGCATCTGGAGG - Intergenic
1054988024 9:71285243-71285265 GTGTGCACCATGTTATCTGACGG + Intronic
1057831164 9:98408402-98408424 AGGGTCACCATGGCATCTGTTGG + Intronic
1185721674 X:2387585-2387607 GTGGCCACCATGTCATCAGCAGG - Intronic
1187285495 X:17899688-17899710 TGGGACACCAAGGCCTCTGAGGG - Intergenic
1193291753 X:79781361-79781383 GGGGACACCTGGTCATGTGTGGG - Intergenic
1199326275 X:146502278-146502300 GGGGACGCCAGGTCATATGAGGG - Intergenic
1200160710 X:154007086-154007108 GCGGAGGCCACGTCATCTGATGG - Intergenic