ID: 954592960

View in Genome Browser
Species Human (GRCh38)
Location 3:51799694-51799716
Sequence CCTGCAATGCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954592953_954592960 29 Left 954592953 3:51799642-51799664 CCTGGATGTTGGTTGTAATGGCT No data
Right 954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954592960 Original CRISPR CCTGCAATGCAGAGGGAAGA TGG Intergenic
No off target data available for this crispr