ID: 954596513

View in Genome Browser
Species Human (GRCh38)
Location 3:51829934-51829956
Sequence AAGGCCCAGGAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 12, 3: 54, 4: 613}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954596505_954596513 12 Left 954596505 3:51829899-51829921 CCACCTGATAGGTGGGGCTCAGC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG 0: 1
1: 0
2: 12
3: 54
4: 613
954596506_954596513 9 Left 954596506 3:51829902-51829924 CCTGATAGGTGGGGCTCAGCACA 0: 1
1: 0
2: 2
3: 8
4: 121
Right 954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG 0: 1
1: 0
2: 12
3: 54
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954596513 Original CRISPR AAGGCCCAGGAGAATGAGGA GGG Intronic
900509212 1:3050523-3050545 GGGGCCCAGGAGAATGAAGATGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902801317 1:18831922-18831944 TGGGCCCAGGTGAGTGAGGATGG - Intergenic
902879649 1:19362905-19362927 AAGCTCCAGGAAGATGAGGAGGG + Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903342326 1:22662176-22662198 AAGGCCCAGTAGAGTGAGGCTGG - Intergenic
904000366 1:27335408-27335430 GATGCCCAGGAGAAGGATGAAGG - Exonic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904683914 1:32247461-32247483 GAGGACGAGGAGGATGAGGAGGG + Exonic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905108668 1:35578660-35578682 TTGGCCCTGGAGAAGGAGGAGGG + Intronic
905973443 1:42157633-42157655 AAGGCCCCAGTGAGTGAGGATGG - Intergenic
906561386 1:46760401-46760423 CAAGCCCAGGAGAAGTAGGAAGG - Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908494018 1:64676825-64676847 AAGGACCAGGAGCATGAGTTTGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909299529 1:73994532-73994554 AAGGCACAGGGGAGTAAGGAAGG - Intergenic
910220998 1:84889357-84889379 AAGGCACAGGGGAGTGAGGATGG + Intronic
910523114 1:88146088-88146110 AAGGCTCAGGAGTATGAAGAGGG - Intergenic
910799774 1:91133428-91133450 AAGTTCCAGGAGAAAAAGGAGGG - Intergenic
911115319 1:94240027-94240049 AAGGCCAAGGAGAGTGGGGTTGG + Intronic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913591874 1:120336814-120336836 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
913651482 1:120918332-120918354 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914169627 1:145210738-145210760 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914524740 1:148454700-148454722 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914598934 1:149181133-149181155 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914641660 1:149612435-149612457 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
915592577 1:156879058-156879080 AACTCCCAGGAGCCTGAGGAAGG - Intronic
915594475 1:156888295-156888317 AAGACCCAGGAGGGTGAGGGAGG + Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917633228 1:176910322-176910344 AAGCCCTGGGAGACTGAGGACGG - Intronic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919878164 1:201885637-201885659 ATGGCCCAGGAAAGTAAGGAAGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920038581 1:203081756-203081778 ACTGCCCTGGGGAATGAGGAGGG - Intergenic
920402268 1:205683370-205683392 TAGCCCAAGGACAATGAGGAGGG - Intergenic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921050658 1:211509010-211509032 AAGGGCAAGGAGGATGAGAAAGG + Intergenic
921513639 1:216063383-216063405 AAGACTCAGGATAATGAGGAGGG - Intronic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
923051314 1:230393070-230393092 AAGGCGGAGGAGGAAGAGGAAGG + Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923857811 1:237863741-237863763 ACGGCCCATGAGAAAGAGGCAGG + Intergenic
924575518 1:245277432-245277454 AAGCCCCAGGGCACTGAGGAAGG - Intronic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063366489 10:5493984-5494006 AGGGCCCAGGAGACTAAAGAAGG - Intergenic
1063366527 10:5494141-5494163 AGGGCCCAGGAGACTAAAGAAGG - Intergenic
1063982216 10:11463303-11463325 AAGGCCCTGGATGCTGAGGACGG - Exonic
1064190766 10:13203670-13203692 AGGACCGAGGAGAATGAGAAGGG - Intronic
1064397587 10:14993875-14993897 GAGGCCCCGGAAAAGGAGGAAGG - Intergenic
1065173398 10:23053965-23053987 AAAGCACAGGAGAAAGAAGAAGG - Intergenic
1067179211 10:43972228-43972250 AGGGCCCAGGGGAGTGGGGACGG + Intergenic
1067416183 10:46105181-46105203 GAGGGCTAGGAAAATGAGGAGGG + Intergenic
1067450776 10:46380712-46380734 GAGGCCCAGGGAAATGAGGCTGG + Intronic
1067586467 10:47479039-47479061 GAGGCCCAGGGAAATGAGGCTGG - Intronic
1067783545 10:49226572-49226594 AAGGCTCAGGACAAAGAGAATGG - Intergenic
1067878957 10:50027222-50027244 CAGGCCCAGGACGATGAGCAGGG + Intergenic
1067892781 10:50150714-50150736 CAGGCCCAGGACGATGAGCAGGG - Intergenic
1068303387 10:55175138-55175160 AAGACACAGGAGAATGAAGAAGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068688662 10:59894300-59894322 AATGCCGAGAAAAATGAGGATGG - Intronic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1069422544 10:68260348-68260370 AAGCCCCAGGAGGATGAGGCTGG - Intergenic
1069608469 10:69756209-69756231 AAGGCCCTGGAGAGTAAAGATGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070494839 10:77012038-77012060 AATGCCCTGGAGAAAGAGAATGG + Exonic
1071689864 10:87805681-87805703 AGGTCCCAGAAGAATCAGGAGGG - Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1072289639 10:93952293-93952315 AAGGACCTGGAGAGTGAGGAGGG + Intronic
1073048794 10:100654971-100654993 AAGGCCCAGGAGGAAGACGGGGG - Intergenic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1073605828 10:104894810-104894832 TAGGTGCAGGAGAATGATGATGG + Intronic
1075200567 10:120400105-120400127 AATTCCCAGGAAAATGAGGTAGG - Intergenic
1075863697 10:125698928-125698950 AGGGCCCAGGAAGATGAGAATGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1077162943 11:1121864-1121886 AAGGCCCAGGAGGACGGGGTGGG - Intergenic
1078095288 11:8292662-8292684 AGGGCCCAAGAGAAGGAGGCAGG + Intergenic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1079745781 11:24127795-24127817 AAGGCACTGCAAAATGAGGATGG - Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080369471 11:31618448-31618470 AAGAACCAGGAGAGTGAGAAAGG + Intronic
1080461920 11:32462242-32462264 TAGGCCCAGGAGAGTTAGAAGGG + Intergenic
1080668938 11:34358456-34358478 TGGGGCCAGGAGAATGGGGAGGG + Intergenic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1081646066 11:44791547-44791569 AGTGCCCAGGAGAAGGAGGCGGG - Intronic
1081709236 11:45206298-45206320 GAGGCCCAGATGAAAGAGGAGGG + Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083896880 11:65624489-65624511 GAGGCCCAGGAGGAAGACGAAGG - Exonic
1084228070 11:67729851-67729873 GAGGCCCTGGACAAGGAGGAAGG - Intergenic
1084261470 11:67981532-67981554 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1084575799 11:69987144-69987166 AAGGCCCAGAAGAAAGAGAAAGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084691879 11:70732353-70732375 AGGGCCCAGGAGAGAGAGGAAGG - Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1084807155 11:71587014-71587036 GAGGCCCCGGACAAGGAGGAAGG + Intronic
1084844239 11:71887023-71887045 GAGGCCCCGGACAAGGAGGAAGG + Intronic
1084847094 11:71909481-71909503 GAGGCCCTGGACAAGGAGGAAGG + Intronic
1084961103 11:72717144-72717166 AAGGCCCAAGAGCATGAGCTGGG + Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085150247 11:74246672-74246694 AAGGCATAGATGAATGAGGAAGG - Intronic
1085792856 11:79510935-79510957 AAGGACCAGGAGTAGGAAGAGGG - Intergenic
1086570617 11:88279867-88279889 TAGACCCAGGAAAATGAGGCAGG - Intergenic
1086884046 11:92183206-92183228 AAGGCACAAGAGAAATAGGAAGG + Intergenic
1087329473 11:96762117-96762139 AAAGCCCAGGAGAATGATTTAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088579538 11:111301051-111301073 GAGTTCCAGAAGAATGAGGAGGG - Intronic
1088604561 11:111515328-111515350 AAAGCCCTGGAGAAAGATGAAGG + Intronic
1089519802 11:119056362-119056384 AAGGCCCAAGTGAAAGAGCATGG + Intronic
1089627532 11:119761242-119761264 AAGGCCCAGGTGAGTGGGGTCGG + Intergenic
1090726942 11:129536514-129536536 TAGGCACAGTGGAATGAGGAAGG - Intergenic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091748919 12:3010648-3010670 AAGGCCCAGGAGAAAGTGTGGGG + Intronic
1092432757 12:8422101-8422123 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1092435354 12:8442739-8442761 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1092660644 12:10734528-10734550 AAGGCCCAGGAGAGAGTTGATGG + Intergenic
1093394154 12:18660211-18660233 AATACGCAGGAGAATGGGGATGG - Intergenic
1093473072 12:19525599-19525621 AAGGCACAGGAGGCTGAGGCAGG - Intronic
1093943998 12:25086631-25086653 AAGGCAGAGGAGACTGAGAACGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094303431 12:28991791-28991813 AAGGCCCAGCAGAAACAGGAGGG - Intergenic
1094329064 12:29273009-29273031 AGGTCCCAGGAGAAGGAGCAGGG - Intronic
1094610619 12:31992130-31992152 ACAGCCCAGGGCAATGAGGATGG + Intronic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1096255346 12:50058776-50058798 AAGGCCGAGGAGGAGGAGGTGGG + Exonic
1096505329 12:52088894-52088916 AAGGCCCAGAAGACTGGAGATGG - Intergenic
1096866475 12:54566647-54566669 AGGGCCCAGCAGAATTAGGCAGG - Intronic
1097801472 12:63919162-63919184 CAGTCCCAGGAGACTGAGGTGGG - Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1102730475 12:115104416-115104438 AAGGACCATGAGAATGATTAAGG + Intergenic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104733350 12:131121207-131121229 AAGGCACCGGAGGATGGGGAAGG - Intronic
1105468631 13:20671380-20671402 AAGTGCCACGAGAAGGAGGATGG + Intronic
1105947865 13:25204694-25204716 AATCCTCAGGAGGATGAGGAAGG + Intergenic
1106051814 13:26197591-26197613 AAGACCCATGAGAAGGAGTAGGG - Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107433708 13:40362976-40362998 AACGCCGAGGAGGAGGAGGAGGG - Intergenic
1107504207 13:41015119-41015141 AAGCCCCAGGAGTAAGAGTATGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108985847 13:56586129-56586151 AAGGGCCTGGAGGATGTGGATGG - Intergenic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1111895150 13:94132597-94132619 AAGACCCAGGAGGCTGGGGAGGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112847414 13:103661118-103661140 AAGGCCCAAGTTCATGAGGAAGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1117038434 14:51749585-51749607 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117275743 14:54191329-54191351 AAGCTCCAGGAGAACAAGGATGG + Intergenic
1117653912 14:57934852-57934874 AAGACACAGAAGAATGAGGGAGG + Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1119428717 14:74552044-74552066 GAGGGCCAGGAGAAAGAGGGAGG + Intronic
1119469233 14:74883351-74883373 GAAGCCCAGGAGAAAGAGAATGG + Intronic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1121552737 14:94814640-94814662 ACGTCCCAGCAGCATGAGGATGG + Intergenic
1121670849 14:95709760-95709782 AGGGCACATGGGAATGAGGAGGG + Intergenic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122956834 14:105075117-105075139 GAGGCCCAGGGCCATGAGGAGGG - Intergenic
1123063988 14:105606922-105606944 AAGGCCCAGGCCACTGAGGCAGG - Intergenic
1123073301 14:105652565-105652587 AAGGCCCAGGCCACTGAGGCGGG - Intergenic
1123093226 14:105751332-105751354 AAGGCCCAGGCCACTGAGGCGGG - Intergenic
1123418236 15:20108030-20108052 AGAACCCAGGAGAATGGGGAGGG + Intergenic
1123527454 15:21114552-21114574 AGAACCCAGGAGAATGGGGAGGG + Intergenic
1123880822 15:24676332-24676354 AGGGCCCAGAAGAGTGAAGAAGG + Exonic
1124055477 15:26237738-26237760 AAAACACAGGAGAATGAGAAAGG + Intergenic
1124701852 15:31920916-31920938 AAGGTGCAGGAGAATGATAAAGG - Intergenic
1125089764 15:35776608-35776630 AAGGCCCAAAAGAAGGAGAATGG + Intergenic
1125332673 15:38597541-38597563 AAGGTCCAGGGGAAGGAAGAAGG - Intergenic
1125845976 15:42854150-42854172 GAGGCCCAGGAGTATGAGATCGG - Intronic
1125892488 15:43276770-43276792 ACTGCACAGGAGACTGAGGAGGG + Intronic
1126196338 15:45936097-45936119 AAGGCCCACGAGGATATGGAGGG - Intergenic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1127122372 15:55782802-55782824 AAGGCCAAGGAGAATAAAGATGG + Intergenic
1127318042 15:57815989-57816011 GAGGCCCATAAGAAAGAGGATGG + Intergenic
1127441048 15:59008545-59008567 AAGTGCCAAGATAATGAGGAAGG - Intronic
1127929364 15:63581804-63581826 TAGTCCCAGGAGACTGAGGTGGG - Intronic
1128122088 15:65158110-65158132 TAAGCCCAGGAGATTGAGGCTGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128865057 15:71108555-71108577 AAGGGACAGGACAATGGGGAGGG + Intronic
1129062867 15:72874176-72874198 AGGGCCCAGCAGAGTCAGGAGGG + Intergenic
1129301979 15:74630732-74630754 AAGGCCCAGGCTAAGGATGAGGG + Exonic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130388358 15:83432958-83432980 AGGGCCCAGGAAAAAGATGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131906576 15:97149284-97149306 AGGCCCCTGGAGAATGAAGAAGG - Intergenic
1132619204 16:856414-856436 AAGGCCCAGGAGAGTGTGCAGGG - Intronic
1132838012 16:1964444-1964466 AAGGCCGAGGATAAGGAGGTAGG - Exonic
1132933452 16:2469998-2470020 AAGGACCAGGAGGAAGAGAATGG - Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133327228 16:4949154-4949176 GAGACCCAGGAGAACCAGGAAGG - Intronic
1133435921 16:5779622-5779644 TGAGCCCAGGAGAATGAAGAGGG - Intergenic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1135544068 16:23354160-23354182 GAGGCCCAGGAGGTTAAGGAAGG - Intronic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1136226678 16:28864542-28864564 GAGGCCCAGGAGGAAGGGGAGGG + Intronic
1136356119 16:29745690-29745712 AAGTCCGAGGAGAATGGTGAGGG - Intronic
1136994624 16:35181358-35181380 AGGCACCAGGTGAATGAGGATGG + Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137630249 16:49938225-49938247 AAAGCCCATGAGAAAGAGGCGGG + Intergenic
1137725645 16:50654917-50654939 GAGGCCCAGGAGAATGGGCCTGG + Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1138659821 16:58510382-58510404 GAGGCCTAGGAGAATGGTGAGGG + Intronic
1139267606 16:65654923-65654945 AAGGACCAGAAGAGAGAGGAGGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139506054 16:67398622-67398644 GAGGCCCAGAAGGATGAGCAGGG + Exonic
1139650933 16:68361739-68361761 AGGGTCCTGGAGAGTGAGGAGGG - Exonic
1140114014 16:72026196-72026218 AAGCCCAGAGAGAATGAGGAGGG - Intronic
1140250461 16:73290150-73290172 TAGGCACAGGGGAATCAGGAAGG + Intergenic
1141194776 16:81852254-81852276 AAGTCCCAGGAGGATGCTGATGG + Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142305523 16:89282412-89282434 AAGGCCGAGAAGAAAGAGAAGGG - Exonic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1142498982 17:321797-321819 AAGGCCCAGGAGCTGGCGGATGG - Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143647266 17:8238787-8238809 AAGGCCTAAGAAAATAAGGATGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144605662 17:16663417-16663439 AAGGCACAGGAGGAGGAGGTGGG + Intergenic
1145928490 17:28666031-28666053 AAGGCCCAGGAGAGGAAGAATGG - Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146366550 17:32233435-32233457 AGGGCTCAAGAGAATGAGCAAGG - Intronic
1146479769 17:33195822-33195844 ATGACCCAGGAGGGTGAGGAGGG - Intronic
1146543665 17:33719321-33719343 AGGACCCAGGAGACTCAGGAGGG + Intronic
1147722748 17:42548739-42548761 CAGGCCCAGGAGACAAAGGAGGG - Intergenic
1148078368 17:44953092-44953114 AAGGGGCAGGACATTGAGGAAGG + Intergenic
1148352382 17:46950349-46950371 AAGGGCCAGGAGGGTGAGGATGG + Intronic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1148694461 17:49550541-49550563 AAGGCCCACAGGACTGAGGACGG - Intergenic
1148777768 17:50105292-50105314 AAGGCCCAGTTGAATGAAGTGGG + Intronic
1148785887 17:50146025-50146047 GGGGCCCAGGAGACTGAGGAGGG + Intronic
1148821212 17:50360737-50360759 GAGGCCCTGGAGAGTGAGGCAGG - Exonic
1149334673 17:55623334-55623356 AATTCCCAGGAGAAAGATGAAGG - Intergenic
1149439633 17:56663673-56663695 GATGCCCAGGAGAATGACGGGGG + Intergenic
1149470071 17:56909208-56909230 AAGGTCCAGGAGAAGGGGGAAGG + Intronic
1149775737 17:59355598-59355620 AGAGCTCAGGAGAAAGAGGAGGG - Intronic
1150292199 17:63988404-63988426 ATGGCCCAGAAGAATCCGGAGGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1151285388 17:73107454-73107476 AAGGCCCCAGGGAATGGGGAAGG + Intergenic
1151521382 17:74632812-74632834 CAGGCCCAGGAGTTTGAGGATGG + Intergenic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1152252622 17:79219800-79219822 AAGGCACAGGATAAGGGGGAGGG + Intronic
1152391507 17:80006494-80006516 AAGGCCCCGGGGGATGGGGATGG + Intronic
1152891586 17:82884632-82884654 AAGGCCCAGGCGAGTGTGGCGGG - Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154255078 18:12775616-12775638 AAGGCGCTGGAGAAGGAGGGTGG - Intergenic
1155130327 18:22928336-22928358 AGGGCATGGGAGAATGAGGAAGG + Intronic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156476691 18:37410010-37410032 AAGGCCAATGAGAATGATGGAGG + Intronic
1156477147 18:37412776-37412798 AAGGCCAATGAGAATGATGGAGG + Intronic
1156494965 18:37519696-37519718 AAGGCCCAGGCCACTGAGGGGGG - Intronic
1157314849 18:46578886-46578908 GAGGCTCAGGAGAATGAAGCAGG + Intronic
1157555515 18:48610591-48610613 GAGGCCCTGGAGAGGGAGGAAGG - Intronic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159345160 18:67192712-67192734 AAGGTCCAGGAAAATGGGAAGGG - Intergenic
1160946127 19:1644844-1644866 GAGGCCCAGGAGAATGGGGGTGG + Intronic
1161328071 19:3672926-3672948 AAGGCCCAGGATGATGAAGCTGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162309398 19:9896600-9896622 AAGGCCCTGGGGTAAGAGGAAGG - Intronic
1163156481 19:15442584-15442606 AAGCCCCTGGGGAATGAGAAGGG - Intronic
1163495241 19:17642741-17642763 GAGGGCCAGGAGAGTGTGGATGG + Intronic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1164169185 19:22709360-22709382 AGAGTCCAGGGGAATGAGGAGGG + Intergenic
1164765087 19:30758488-30758510 AAAGCACAGGAGAAAGATGAAGG + Intergenic
1165152307 19:33768001-33768023 AGGGCTCACGAGGATGAGGAAGG - Intronic
1165337422 19:35181251-35181273 AAGGCTCAAGAGAATGTGAAAGG + Intergenic
1166381796 19:42358624-42358646 AAGGCCAAGGAGAATGTGTGTGG + Intronic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167324384 19:48814985-48815007 AAGGCCCATGGGAAGGAGTAGGG + Intronic
1167341938 19:48921549-48921571 AAGGCCCAGGAGGGGGAGAAAGG + Intronic
1167498202 19:49831292-49831314 GAGGGCCATGAGAATGGGGAAGG - Intronic
1167610651 19:50506384-50506406 GAGGCCCTGGGGGATGAGGACGG - Exonic
1168217807 19:54939359-54939381 TACGCCCTGGAGAAGGAGGAGGG - Exonic
925130154 2:1488785-1488807 AAGGGCCAGGGGACAGAGGAAGG - Intronic
925665110 2:6245109-6245131 ATGGCCCAGGAGACAGAGGAGGG - Intergenic
925751188 2:7091470-7091492 AAGGCCCTGGAGGAGGAGGAAGG + Intergenic
925904773 2:8534033-8534055 AATGCTCAGGAGGATGAGGAGGG + Intergenic
926245743 2:11121520-11121542 CAGGCCCCTGAGACTGAGGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929915035 2:46127959-46127981 AAGTCACAGGAGTATCAGGAAGG + Intronic
929915540 2:46132583-46132605 CAGGCTCAGGCGAATGAGGCCGG - Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931489086 2:62725235-62725257 AAGGCACAAGCAAATGAGGATGG - Intronic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932353141 2:71047882-71047904 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
933078037 2:77954274-77954296 ACGGCACAGGAGACTGAGGCAGG + Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934517616 2:94998622-94998644 AGGGCCCTGGAGAAGGAGGGTGG - Intergenic
934818103 2:97347940-97347962 AAGGGCGAGGAGAATGTGGTTGG + Intergenic
934819593 2:97360545-97360567 AAGGGCGAGGAGAATGTGGTTGG - Intergenic
937192157 2:120112884-120112906 AAGGCACAGAACAATGAGGCTGG + Intronic
937323073 2:120972491-120972513 ATCACCCAGGAGAATCAGGAAGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938140413 2:128790420-128790442 ACGGCTCACGAGAATGAGCAAGG - Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
938733301 2:134163248-134163270 AAGGCCCTCCAGAATCAGGAAGG - Intronic
938795288 2:134713705-134713727 AAGGCCCAGCTGAATGTGGGTGG - Intronic
939133948 2:138272235-138272257 AAGGCCCAGAAGACTGAGTCTGG - Intergenic
940816325 2:158301762-158301784 GAGGTCCAGGAGGATCAGGATGG + Intronic
940871841 2:158867176-158867198 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
942996261 2:182264013-182264035 GAGCCCAAGGAGACTGAGGATGG + Intronic
943065760 2:183084477-183084499 AAGGCCCAGAAGCAAGAGAAAGG + Intronic
943548175 2:189307599-189307621 GAGGGCTAGGAAAATGAGGATGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
944145549 2:196503669-196503691 ACAGCCCAGCAGAATCAGGAGGG + Intronic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
944848712 2:203695111-203695133 AGGCCCCAGGGGAAAGAGGAGGG + Intergenic
944882388 2:204026682-204026704 AAGCCACAGGAGAATGAGGAAGG + Intergenic
946191437 2:218010011-218010033 AATGCCCAGGAGACTGCGGGAGG + Intergenic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946422844 2:219574729-219574751 CTGGCCCAGGAGGCTGAGGAGGG + Exonic
946505026 2:220290111-220290133 GATGCTCAGGAGACTGAGGAAGG - Intergenic
947671452 2:231939075-231939097 AGAACCCTGGAGAATGAGGAAGG + Intergenic
947849292 2:233272216-233272238 GTGGCCCAGAAAAATGAGGAAGG + Intronic
947913446 2:233817486-233817508 AAGGCTCAGCAAAATGAGGCAGG + Intronic
948542466 2:238700397-238700419 GTGGCACAGGAGAATGAGGGGGG + Intergenic
948681255 2:239636217-239636239 AAGGCACAGGAGGTTGAGGAGGG - Intergenic
948809183 2:240466241-240466263 AAGGGCCAGGAAGAGGAGGAGGG - Exonic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168900975 20:1364685-1364707 AAGGCAGAGGAGAATGAAGGAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1171088687 20:22263545-22263567 AAAGCCCAGGACAATGTTGAAGG + Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172008844 20:31834601-31834623 CAGGCCCAGGAGAATTAGGAAGG + Exonic
1172071026 20:32257257-32257279 AAGGACCAGATGAATGAGGCAGG + Intergenic
1173147258 20:40535525-40535547 AAGGCCCTGGAGAAAGAGTGTGG - Intergenic
1173644963 20:44627506-44627528 AAAGCCCAGGAGAATGGTGGAGG - Intronic
1173959196 20:47058105-47058127 TTGGCCCAGGAAAAGGAGGAAGG + Intronic
1174246792 20:49187989-49188011 GAGGCCCGGGAGAAGGCGGAGGG + Intronic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1175061736 20:56249571-56249593 CACGCCCAGGAGAATGGTGATGG - Exonic
1175128014 20:56766886-56766908 GATGCACAGGAGGATGAGGATGG + Intergenic
1175230406 20:57470208-57470230 AACGCCCAGGTGGATCAGGAAGG - Intergenic
1176100278 20:63361473-63361495 AGGGCCAGGGAGAATGAGCAGGG + Intronic
1176154651 20:63612481-63612503 AAGGCCCAGGAAAAGGCGGGAGG + Intronic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179589622 21:42397875-42397897 AAGGCCCAGGGGCATGGGAAGGG + Intergenic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179984745 21:44914085-44914107 AGGGCCTTGGAGAATGAGGAGGG - Intronic
1181086183 22:20440485-20440507 AGGGCCCAGGACAGTGAGGAAGG + Intronic
1181119007 22:20652964-20652986 CAGGCCCAGGATGATGAGCAGGG - Intergenic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1182764399 22:32748275-32748297 GTGGCCCAGGAGAAAGAGCATGG + Intronic
1183101818 22:35588808-35588830 AAGGGCCAGGAGAAGGAATAGGG + Intergenic
1183306536 22:37085940-37085962 CAGGTCCAGGCGAGTGAGGAGGG + Intronic
1183498343 22:38163220-38163242 AAGGCCCAGAGGACAGAGGAGGG - Intronic
1184130472 22:42514067-42514089 AAGGCCGAGGGGTCTGAGGATGG + Intronic
1184140649 22:42575892-42575914 AAGGCCGAGGGGTCTGAGGATGG + Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
1184763752 22:46561052-46561074 AACCCCCAGGAGGGTGAGGAAGG + Intergenic
1184804037 22:46781020-46781042 AATGCCCAAGAGAAAGAGAATGG - Intronic
1185102042 22:48845767-48845789 CAGCCCCAGGAGCATGGGGATGG - Intronic
1185234796 22:49705426-49705448 AAGGCGGAGGGGAGTGAGGAGGG + Intergenic
1185264737 22:49894990-49895012 GAAGCCCAGGAGGAGGAGGAGGG + Intergenic
1185315939 22:50179140-50179162 GAGGCCCGGGAGGAGGAGGACGG + Exonic
949373418 3:3360606-3360628 AAGTCCCAGGAAAGTGAGGTAGG + Intergenic
949882684 3:8674355-8674377 GAGGCCCCGGACAAGGAGGAAGG + Intronic
950102436 3:10366243-10366265 AGGGCCGAGGAGAAAGGGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950665968 3:14495117-14495139 AAGGCCCAGGGGCAAGAGGCTGG - Intronic
951116881 3:18874002-18874024 AAGGCCCAGGAGAAATTGAAAGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952206948 3:31189875-31189897 AAGGCCCAGGAGATTGAGTAGGG + Intergenic
952697897 3:36291507-36291529 AAGGCCCAGAAGAAAGGGGTGGG - Intergenic
952932016 3:38367825-38367847 AATGCCAAGGAGATAGAGGAAGG + Intronic
953336533 3:42098867-42098889 AAGTCCCACGAGAGTGAGGGAGG + Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
954923185 3:54209331-54209353 AAGGGCCAGGAGGGTGAGGCTGG - Intronic
954955177 3:54512515-54512537 AAGGTGCAGGAGAAAAAGGAAGG - Intronic
955390684 3:58520337-58520359 AAGCCACAGGAGACTGAGGCTGG + Intronic
957044754 3:75364916-75364938 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
958896527 3:99835940-99835962 AAGGCCCAGTAGTATGTGGGAGG + Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959814035 3:110653915-110653937 AATCCCCAGGAGAATGACTACGG + Intergenic
960574350 3:119215286-119215308 GAAGCCCAGGAGAAAGATGAAGG - Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
960997346 3:123348858-123348880 GAAGGGCAGGAGAATGAGGAGGG - Intronic
961009603 3:123426950-123426972 AAAGCCCAAGAAAAGGAGGAAGG + Intronic
961274752 3:125718077-125718099 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
961277671 3:125740708-125740730 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961876751 3:130028954-130028976 GAGGCCCTGGACAAGGAGGAAGG - Intergenic
962411915 3:135148445-135148467 AAGTCCCAGGAGACTCAGGCTGG - Intronic
963749909 3:149165941-149165963 AATGACCAGGAGAATAAGGTTGG - Intronic
964296441 3:155239471-155239493 ATGGCACATTAGAATGAGGATGG - Intergenic
964323870 3:155525985-155526007 AAGGCCCAGGGGTCTGAGAAAGG + Intronic
965107796 3:164380338-164380360 GAGGCCAAGGAGAATCTGGAAGG - Intergenic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
967778236 3:193406835-193406857 AAGGCCCAGGAGAAGGCAGAAGG + Intronic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
968896330 4:3406073-3406095 GAGGGCCAGGAGAATGAAGATGG - Intronic
968940189 4:3633644-3633666 ATGGCCCAGGAGAGTGACGTGGG + Intergenic
968953008 4:3704232-3704254 TAGTCCCAGGAGAATGGGGAGGG + Intergenic
968989018 4:3896157-3896179 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
969019997 4:4133399-4133421 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
969024699 4:4163801-4163823 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
969300076 4:6292400-6292422 AAGGCCCAGGAGACCCAGCAGGG + Intronic
969315206 4:6377724-6377746 GGGGCCCAGGTGAAGGAGGATGG + Intronic
969733858 4:8974014-8974036 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
969785294 4:9452897-9452919 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
969788707 4:9477303-9477325 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
969793445 4:9508071-9508093 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
970912592 4:21294447-21294469 TATGCCCAGGAAAATGGGGAAGG - Intronic
971172084 4:24243730-24243752 AAGGGCCAGGCTAAGGAGGAAGG - Intergenic
971264565 4:25086464-25086486 AAGGCCAAGGATAATAAAGATGG + Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972157945 4:36188208-36188230 AGGGTCCAGGAAAATGAAGATGG - Intronic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
974136163 4:57821133-57821155 AAGGCGCAGGAGAGAGAGTAGGG + Intergenic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
977066654 4:92325388-92325410 AAGGCACAGAAGAAAGGGGAAGG - Intronic
977196260 4:94064517-94064539 GAGGCCCAGGTGCATAAGGAAGG - Intergenic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
978553193 4:109950019-109950041 AAGGCCCAGAAGAAGGACCAGGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978831044 4:113085423-113085445 TAGTCCCAGGAGAATGAGGCAGG - Intronic
979077207 4:116287478-116287500 ATAGCCCAGGAGAATGAGGGAGG + Intergenic
979983547 4:127287367-127287389 AGGGCGCAAGAGAATGAGGGAGG - Intergenic
980487133 4:133473417-133473439 GAGGCCCAGGAGGCTGAGGCAGG - Intergenic
980528560 4:134020559-134020581 GAGGGCCAGGAAAATGAGGCTGG - Intergenic
981104300 4:140863201-140863223 GGGGCTCAGGCGAATGAGGAGGG + Exonic
981259370 4:142701341-142701363 TATAGCCAGGAGAATGAGGAAGG + Intronic
981399054 4:144290571-144290593 AAGGACCTAGAGGATGAGGAGGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982208414 4:153015352-153015374 GAGGCCCAGGAGTATGAACAAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982287744 4:153753049-153753071 AAGTCCAAGGAGAATGAGAGAGG + Intronic
982346191 4:154362742-154362764 ATGGCCGAGGAGGAAGAGGAAGG - Intronic
983172627 4:164552915-164552937 AAAGCCCAGATGAATGAGAATGG - Intergenic
983996481 4:174188741-174188763 AAGGCACCTGACAATGAGGATGG + Intergenic
984288250 4:177761291-177761313 GGGGCCCAAGGGAATGAGGAGGG + Intronic
984338269 4:178419766-178419788 AACGTCCAGGGTAATGAGGAAGG + Intergenic
985590641 5:762941-762963 AATGGCCAGGATAGTGAGGAAGG + Intronic
986228203 5:5836764-5836786 ATGACACAGGAGAATCAGGAGGG - Intergenic
987515046 5:18895109-18895131 AATGCCAAAGAGCATGAGGATGG - Intergenic
987561418 5:19526944-19526966 AATGCCCATGAGAATAAAGATGG + Intronic
987969479 5:24923606-24923628 AATGCCAAGGACAATGAGCAAGG - Intergenic
988018304 5:25590027-25590049 AAGGACTATGAGACTGAGGAAGG + Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990224986 5:53640319-53640341 AAGGTCCAGAAGGAAGAGGAAGG + Intronic
990245576 5:53860180-53860202 AAGTCCCAGGAGCAAGTGGAAGG + Intergenic
991203294 5:64019313-64019335 AAGGCACAGGAGGAAGAGAATGG + Intergenic
991532752 5:67634028-67634050 AAAGCCCAGAAGAGTGAGAAAGG + Intergenic
991660480 5:68945878-68945900 AAGGCACAGGAAAGTGAGGTAGG + Intergenic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
992685426 5:79194868-79194890 AAGGCCCAGAAGTACTAGGAAGG + Intronic
992733658 5:79697280-79697302 AACTCCCAGGGGAATGAGCAAGG - Intronic
994005862 5:94836481-94836503 AAAGCACAGGAGACTGAAGAAGG - Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
999177793 5:149643665-149643687 TGGGCCCAGGAGAGTGAGGCTGG + Intergenic
999247703 5:150163965-150163987 AAGGCCCTGGGGAGTGGGGAAGG - Intergenic
999255971 5:150210207-150210229 AGGGCCCTGGAGGATGGGGAAGG + Exonic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1001105836 5:168853873-168853895 AAGGCCTTGATGAATGAGGAGGG - Intronic
1001179428 5:169505419-169505441 AAGGCACAGGATAATGATGGTGG - Intergenic
1001224381 5:169931238-169931260 GACGACCAGGAGAGTGAGGAAGG + Intronic
1001334032 5:170783143-170783165 GAGGCCCAGGAGGAGGAGGCGGG - Intronic
1001654678 5:173340452-173340474 AAGGGCCAGGGGAAGGAGTATGG + Intergenic
1002380960 5:178829619-178829641 AATTCCCAGGAGAGTGATGACGG - Intergenic
1003192467 6:3886649-3886671 AAGGCCCTGCAGAAACAGGACGG + Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1005068557 6:21842927-21842949 AAGGCTCAGGGTTATGAGGATGG + Intergenic
1006140075 6:31923218-31923240 GAGGCCCAGTCGAATGTGGAAGG - Intronic
1006407874 6:33855788-33855810 AAGCCCCAGGGGAATCAGGAAGG + Intergenic
1006452645 6:34114038-34114060 CAGACCCAGGTGAGTGAGGAAGG - Intronic
1006652434 6:35562808-35562830 AAGGCTCTGGAGAAGGAGAAAGG + Intergenic
1006696004 6:35931379-35931401 CTGGCCCCGGACAATGAGGAGGG + Intergenic
1006943463 6:37768238-37768260 AACGCCCAGTGGAATGAGGTTGG - Intergenic
1007424762 6:41739803-41739825 GGGGCCCAGGAGGATGAGTATGG - Exonic
1007705098 6:43785679-43785701 AAGGACCAGGGGATGGAGGAAGG - Exonic
1007782698 6:44263551-44263573 GAGGCCCAGGAGAGTGACGGAGG + Intronic
1007956299 6:45920774-45920796 AGGGCCCAGGAGGATTGGGAGGG + Intronic
1008367532 6:50699724-50699746 TAAGCCCAGGGGAAGGAGGAGGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009848386 6:69163609-69163631 AAAGCCCAGGTGAAATAGGATGG + Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011729362 6:90244787-90244809 AAGGCCCATGAGGGTGATGATGG - Intronic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1011987277 6:93464407-93464429 TAGGCCCAGGATAGTAAGGAAGG + Intergenic
1012529672 6:100220462-100220484 AAAGCTCAGGAGAAGGAGAAAGG + Intergenic
1013036757 6:106392483-106392505 AAGGCAAAAGAGAATCAGGAAGG + Intergenic
1013105235 6:107021464-107021486 AAGATCCAGAAGAATGAGGGAGG - Intergenic
1013184342 6:107744963-107744985 AAAGTCCAGGAGAAAGAGGAAGG - Exonic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014362472 6:120497457-120497479 AATGACCAGGAAAATGAAGAGGG + Intergenic
1015759730 6:136645365-136645387 AAGGCCCAGGAAATTTATGAGGG - Intronic
1016249749 6:142026722-142026744 GAGGGCCAGGAAAATGAGGCTGG - Intergenic
1016390571 6:143570614-143570636 GAGCCCCAGGAGAGTGGGGAGGG - Intronic
1018170953 6:161142628-161142650 AGGGCCCAGGAGAAGAAAGAAGG + Intronic
1019104381 6:169656648-169656670 AGGGCCCAGGAGGAGGAGGCTGG + Intronic
1019189146 6:170240128-170240150 CAGCCCCAGAAGAATTAGGAAGG + Intergenic
1019261899 7:86464-86486 AGAGCTCAGGAGATTGAGGATGG - Intergenic
1020307402 7:6845434-6845456 GAGGCCCTGGACAAGGAGGAAGG - Intergenic
1020311874 7:6874260-6874282 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1020794749 7:12665856-12665878 AAAGCCTAGGATAATGAGGTTGG - Intergenic
1021243868 7:18237797-18237819 AAGGCCCAGGAGAAAGGTGTGGG + Intronic
1024519475 7:50292163-50292185 AAGGTCCAGGAAAAGGAGTATGG - Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025936218 7:66039809-66039831 GAGGCCAAGGAGAATCTGGATGG - Intergenic
1025956579 7:66187747-66187769 GAGGCCCAGGAGTTTGAGGCTGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1027231543 7:76275568-76275590 AAGCCCCATGAGGAAGAGGAGGG + Intronic
1027269498 7:76512069-76512091 AAGGCCCAGGAGGAGCAGGTGGG + Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1029078531 7:97954373-97954395 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1029466394 7:100727884-100727906 TAGGCCCAGCAGAAGCAGGAGGG + Intergenic
1029601486 7:101566015-101566037 AAGGCCCAGTGGTATGAGAAGGG + Intergenic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030644532 7:112045128-112045150 AATAGCCAGTAGAATGAGGAAGG - Intronic
1030699139 7:112619650-112619672 CAGGCCCAAGAGAAAGAGAAAGG - Intergenic
1031809467 7:126347706-126347728 AATGCCCAGGAGCTAGAGGATGG + Intergenic
1032423735 7:131803528-131803550 AGACCCCAGGAGAAGGAGGAGGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035668043 8:1393565-1393587 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668048 8:1393611-1393633 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668097 8:1394025-1394047 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668286 8:1395635-1395657 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668322 8:1395957-1395979 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668327 8:1396003-1396025 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1035668341 8:1396133-1396155 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668464 8:1397232-1397254 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668565 8:1398188-1398210 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668570 8:1398234-1398256 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668608 8:1398556-1398578 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668655 8:1398970-1398992 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668826 8:1400488-1400510 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668873 8:1400902-1400924 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668927 8:1401362-1401384 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668977 8:1401822-1401844 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035668982 8:1401868-1401890 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669020 8:1402190-1402212 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669025 8:1402236-1402258 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1035669072 8:1402666-1402688 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669212 8:1403861-1403883 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669232 8:1404045-1404067 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669237 8:1404091-1404113 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669360 8:1405195-1405217 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035669425 8:1405739-1405761 ACGACTCAGGAGGATGAGGAGGG - Intergenic
1035851288 8:2921693-2921715 AATGGCCATGGGAATGAGGAGGG + Intergenic
1036262404 8:7251019-7251041 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1036304184 8:7588539-7588561 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
1036314443 8:7709558-7709580 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1036355037 8:8036531-8036553 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036816965 8:11909511-11909533 GAGGCCCTGGACAAGGAGGAAGG - Intergenic
1036820269 8:11934400-11934422 GAGGCCCTGGACAAGGAGGAAGG - Intergenic
1036833692 8:12041012-12041034 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1036855538 8:12287577-12287599 GAGGCCCCGGACAAGGAGGAAGG - Intergenic
1037596059 8:20355007-20355029 GAGGCCCAGGTGCCTGAGGAGGG - Intergenic
1037834327 8:22207285-22207307 AAGGTCTAGGGGGATGAGGAAGG - Exonic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1037992912 8:23333306-23333328 ATCCCCCAGGAGAGTGAGGAAGG - Intronic
1038238821 8:25788531-25788553 AGGGCCTTGGAGAGTGAGGAAGG - Intergenic
1038271514 8:26079546-26079568 AAAGACCAGGAGGATGAGGAGGG - Intergenic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1038716142 8:29992959-29992981 TAGTCCCAGGAGGCTGAGGAGGG - Intergenic
1040466563 8:47700991-47701013 AAGGCTCAGGAGGGAGAGGAGGG - Intronic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041421663 8:57673445-57673467 AACACCCTGGAGAAGGAGGATGG + Intergenic
1041791428 8:61700113-61700135 GAGGCCCAGGGGATTGAGGGTGG + Intronic
1042158293 8:65867188-65867210 GAGGTCTAGGAGAGTGAGGACGG - Intergenic
1042337986 8:67648551-67648573 AAGGCCCAGAAGGAAGAGGTTGG + Intronic
1042435052 8:68754530-68754552 AAGGCCCAGGGAAATTTGGATGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1044435951 8:92164532-92164554 GAGACACAGGGGAATGAGGAGGG + Intergenic
1045937461 8:107697347-107697369 AAGTCCCAGGAGAAGCAGGTTGG - Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046846165 8:118919129-118919151 AATGCCCAAGAAAATAAGGATGG + Intergenic
1047457515 8:125029403-125029425 ACAGCCCAGGAGAATCAGGGAGG - Intronic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047799846 8:128297426-128297448 ATGGCCGAGGTGAATGAAGATGG - Intergenic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048500543 8:134970889-134970911 AAGACACAGGAGAATGTTGAGGG + Intergenic
1048922132 8:139240828-139240850 AAAGACCAAGAGAATCAGGAAGG + Intergenic
1049009341 8:139876818-139876840 AAGGCCTAGAAGAGTGAGGTGGG - Intronic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1049444563 8:142624093-142624115 AAGGCCGGGGAGCCTGAGGACGG - Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1049913722 9:295832-295854 AATGCCCTGTAGAATGATGAGGG - Intronic
1050096301 9:2070418-2070440 AAGGCTGAGGAGAATGCAGAGGG + Exonic
1052974338 9:34400501-34400523 AAGGCCCAGGGCAGTGGGGACGG - Exonic
1053425685 9:38008564-38008586 AAGGCCCAGGAGCTCCAGGATGG + Intronic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054450567 9:65401653-65401675 ATGGCCCAGGAGAGTGACGTGGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1056865469 9:90224633-90224655 GAGGCCCCGGACAAGGAGGAAGG + Intergenic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1057180780 9:93028918-93028940 CAGGCACAGGAGACAGAGGAGGG + Intronic
1057212525 9:93207977-93207999 AAGCCCCTGGACAAGGAGGAAGG - Intronic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057888105 9:98846347-98846369 AAGGGACTGGACAATGAGGAAGG - Intronic
1059028055 9:110658460-110658482 AAGACCTAAGAGAATGAGCAAGG + Intergenic
1059501954 9:114762444-114762466 TAGTCCCAGGAGGCTGAGGAAGG - Intergenic
1060719398 9:125965205-125965227 AAGGGCCAGCAGCATGTGGAAGG + Intronic
1060862129 9:126962956-126962978 AAAGCCTAGCATAATGAGGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062195472 9:135271144-135271166 AAGGTTTAGGAGAATCAGGAGGG + Intergenic
1062454140 9:136627813-136627835 AAGGACCTGGAGAATGGGGCAGG + Intergenic
1062564735 9:137159143-137159165 GAGGCCCAGGGGAGTCAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1187915482 X:24149580-24149602 GAGACCCAGGAAAATGCGGAAGG - Intronic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188568054 X:31549061-31549083 AAGGCCCATAAAAATGAGGAGGG + Intronic
1189212871 X:39299506-39299528 GAGCCCCAAGAGGATGAGGAAGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189512161 X:41673675-41673697 AAGGCCCACAGGAATAAGGAGGG + Intronic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190338131 X:49275322-49275344 AAGAGCCAGGAGAAAGAGAAGGG - Intronic
1190341962 X:49303987-49304009 AGGGGCCAGGACAAGGAGGAAGG + Intronic
1190388837 X:49911775-49911797 AAGGCACAGGAGGTTGAGGCCGG + Intergenic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1191718926 X:64213139-64213161 CCAGCACAGGAGAATGAGGAAGG + Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1196754805 X:119148763-119148785 AAGGCCCACAAGAATATGGATGG + Intronic
1196909211 X:120468892-120468914 AGGGCCCAGGAGAGTAAGAAGGG - Intronic
1198802221 X:140459610-140459632 AAGGCCCAGGTAAATGTGGCTGG - Intergenic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1199579450 X:149346742-149346764 AAGGCCCTGGAGAAAGGGGTGGG + Intergenic
1200065545 X:153502684-153502706 AAGGCTCAAAAGAATGAGGGAGG + Intronic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic
1200155914 X:153974877-153974899 GAGGCCCAGGAGGATGCGGTGGG + Intronic