ID: 954603271

View in Genome Browser
Species Human (GRCh38)
Location 3:51888894-51888916
Sequence ACAGCGCCATGATGTCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954603271_954603272 -10 Left 954603271 3:51888894-51888916 CCGTGATGACATCATGGCGCTGT No data
Right 954603272 3:51888907-51888929 ATGGCGCTGTCCACTGAGCCTGG No data
954603271_954603275 17 Left 954603271 3:51888894-51888916 CCGTGATGACATCATGGCGCTGT No data
Right 954603275 3:51888934-51888956 TCCACTCTCAGACTTCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954603271 Original CRISPR ACAGCGCCATGATGTCATCA CGG (reversed) Intergenic