ID: 954608146

View in Genome Browser
Species Human (GRCh38)
Location 3:51929540-51929562
Sequence CAGTGTCCCCAGAAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954608139_954608146 1 Left 954608139 3:51929516-51929538 CCTGTCACTGTGCTTCCCTGTAC No data
Right 954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG No data
954608134_954608146 27 Left 954608134 3:51929490-51929512 CCCTTTCTCCATGCCTAGGGAGA No data
Right 954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG No data
954608138_954608146 14 Left 954608138 3:51929503-51929525 CCTAGGGAGAGGTCCTGTCACTG No data
Right 954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG No data
954608135_954608146 26 Left 954608135 3:51929491-51929513 CCTTTCTCCATGCCTAGGGAGAG No data
Right 954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG No data
954608137_954608146 19 Left 954608137 3:51929498-51929520 CCATGCCTAGGGAGAGGTCCTGT No data
Right 954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954608146 Original CRISPR CAGTGTCCCCAGAAAGAGGT GGG Intergenic
No off target data available for this crispr