ID: 954609249

View in Genome Browser
Species Human (GRCh38)
Location 3:51935571-51935593
Sequence CTGTGAGTGTGGATGGGAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 643}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954609249_954609256 21 Left 954609249 3:51935571-51935593 CCCTCTCCCATCCACACTCACAG 0: 1
1: 0
2: 8
3: 81
4: 643
Right 954609256 3:51935615-51935637 TGCCACATTCCACACCTTCACGG 0: 1
1: 0
2: 0
3: 14
4: 214
954609249_954609254 -9 Left 954609249 3:51935571-51935593 CCCTCTCCCATCCACACTCACAG 0: 1
1: 0
2: 8
3: 81
4: 643
Right 954609254 3:51935585-51935607 CACTCACAGCGTCTCCACGTAGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954609249 Original CRISPR CTGTGAGTGTGGATGGGAGA GGG (reversed) Exonic
900320845 1:2082870-2082892 GTGTGAGGGTGCAAGGGAGAGGG + Intronic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
901210466 1:7522095-7522117 CCGTTAGTGGGGATGTGAGATGG - Intronic
902192663 1:14774411-14774433 GGGTGAGTGTGGGTGTGAGAAGG - Intronic
902985744 1:20153091-20153113 CTGTGAGTGTGAGGGGGAAAGGG + Intergenic
903215555 1:21841674-21841696 CTGTGAGGTTGCATGGGGGAGGG + Intronic
903321938 1:22548538-22548560 CTGGGAGGGTGGTTGGGAGGAGG - Intergenic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
904476040 1:30765209-30765231 CTGTGAGTGGGGCTGGGATCTGG - Intergenic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
906568878 1:46819601-46819623 CTGGGAGGCTGGATGGGAGGGGG + Intergenic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907404191 1:54243709-54243731 GTGTCAATGTGGATGGGAGCAGG + Intronic
907530933 1:55096029-55096051 CTGGGAGTGGGGATTGTAGAGGG + Intronic
907679683 1:56551534-56551556 CTTTGAGTGGGGAGGGGAGGAGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909700574 1:78517438-78517460 CTGTGATTGTGGGTGGGAATGGG + Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910677327 1:89827732-89827754 CTGTCAGTGTGGTTAGGATAGGG + Intronic
910737673 1:90479467-90479489 GTGTGTGTGTGGATTGGAGGGGG - Intergenic
912512404 1:110198313-110198335 CGGTGAGTGGGCATGGGGGAAGG - Exonic
912720475 1:112015793-112015815 GAGTGAGGGTAGATGGGAGAAGG - Intergenic
913243705 1:116852743-116852765 CTGGGAGTATGGAAGTGAGATGG + Intergenic
914743562 1:150484973-150484995 GTGTGTGTGTGGTTTGGAGAAGG - Intergenic
914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG + Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
916348255 1:163819235-163819257 ATCTGAGGGTAGATGGGAGAGGG + Intergenic
917499028 1:175569068-175569090 CTGAAAGTGAGGATGAGAGAAGG + Intronic
917795079 1:178527536-178527558 ATTAGAGTGTGTATGGGAGAGGG - Intronic
920029847 1:203030282-203030304 AGGTGAGGCTGGATGGGAGAGGG + Intronic
920216410 1:204364104-204364126 CTTTTAGTGTGGATGAGGGAGGG - Intronic
920293754 1:204943017-204943039 CAGTCAGGGTGGATAGGAGATGG + Intronic
920440033 1:205974373-205974395 GTGTGAGTGTGGGTGGGTGTGGG - Intergenic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
921269827 1:213457502-213457524 CAGTGAGTGTGAAAGGGACAAGG - Intergenic
921709603 1:218360507-218360529 CTGTCAGTGGGGATGGGGTAGGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922005785 1:221529459-221529481 CTGTTAGTGTTGAAGGGACAAGG - Intergenic
922290503 1:224205533-224205555 GTGTGAGTGTGGATGTCAGGTGG + Intergenic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922770162 1:228177309-228177331 CCGTGGGTGTGGCTGGGTGAGGG + Exonic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
923622043 1:235587474-235587496 GTGAGAGTGTGGATGGGGGGTGG + Intronic
923765561 1:236889778-236889800 CTGGGACTGTGGATGTGATATGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924837552 1:247667664-247667686 ATGTGAGTGTTGACTGGAGAAGG - Intergenic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1063482148 10:6385336-6385358 ATGTGAGTGTGAGTGGGAGGAGG - Intergenic
1063589025 10:7378247-7378269 GTGTACGTGTGGATGGGTGATGG + Intronic
1063589046 10:7378346-7378368 GTGTATGTGTGGATGGGTGATGG + Intronic
1063589067 10:7378445-7378467 GTGTATGTGTGGATGGGTGATGG + Intronic
1063589850 10:7385417-7385439 CCGGGAATGTGGAGGGGAGAAGG + Intronic
1063649390 10:7918197-7918219 CTGGGAGTGGGGAAAGGAGAAGG + Intronic
1063660305 10:8031156-8031178 CTGGGCGTGTGGATGAGGGAAGG + Intergenic
1063958284 10:11284969-11284991 ATGAGTGTGTGGATGAGAGATGG + Intronic
1064132573 10:12722984-12723006 ATTTGAGTGTAGATGGGAAAAGG + Intronic
1064167416 10:12998563-12998585 CTGTGACTCTGGATTGGAGCTGG - Intronic
1065712841 10:28533546-28533568 CTGTGAGTGTGTGTCGGGGAGGG - Exonic
1065750331 10:28880016-28880038 CACTGAGTGAGGCTGGGAGAGGG + Intronic
1065895012 10:30155535-30155557 CTGTGAGTGTGACTGTGAGGTGG - Intergenic
1067094494 10:43290215-43290237 CTGTGAGTTTCGATGGAAGCAGG + Intergenic
1067942283 10:50667213-50667235 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1069383839 10:67866366-67866388 TTGTGAGGGTGGCTGTGAGAGGG - Intergenic
1069616727 10:69811093-69811115 GTGGGAGTGAGGATGGGAAAGGG - Intronic
1069893640 10:71667171-71667193 CTGTGAGTGTGCGTGCGTGACGG + Intronic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1070195109 10:74150284-74150306 CAGTGAGTGTGGAAGAGTGACGG - Intronic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1070863529 10:79692171-79692193 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071515258 10:86292695-86292717 GTGTGAGTGTGGATGTGGGTGGG + Intronic
1072930709 10:99659587-99659609 CCGTGAGTGTGGGCGCGAGAGGG + Exonic
1074101543 10:110358177-110358199 CGGGGAGCGTGGCTGGGAGAGGG - Intergenic
1074842048 10:117364077-117364099 TTGTGTGTGGGAATGGGAGAAGG + Intronic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076669836 10:132113789-132113811 GTATGACTGTGGATGTGAGATGG + Intronic
1076694216 10:132239358-132239380 CTGTGATTGTGTGTGTGAGATGG - Intronic
1076858353 10:133128158-133128180 CTGAGAGTGTGGATGGGAACCGG - Intronic
1076991558 11:278704-278726 CTGGGAGTGAGGGTGGGGGAAGG - Intronic
1077098722 11:811521-811543 CTGTGACTCTGGGAGGGAGAGGG + Intronic
1077159580 11:1106551-1106573 ATGGGAGGGTGGATGGTAGATGG - Intergenic
1077260488 11:1616368-1616390 CTGTGAGTGTGGAACCTAGAGGG + Intergenic
1077363664 11:2152539-2152561 CCGTGAGGTTGGAAGGGAGAGGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078836785 11:15037871-15037893 GTGTGAGTGTGGCTAGAAGAGGG + Intronic
1079079882 11:17406839-17406861 TTGGGAGTGGGGATGGGGGAAGG - Intronic
1079353948 11:19714702-19714724 CGGGGCGTGGGGATGGGAGATGG + Intronic
1079391161 11:20023274-20023296 GTGTGAGTGGGGGTGGGAGGGGG + Intronic
1080034189 11:27695069-27695091 TTGTGAGTGTGTATGGGGGTGGG - Intronic
1080455058 11:32411058-32411080 GTGTGTGTGTGTATTGGAGAGGG - Intronic
1080575182 11:33592334-33592356 ATGGCAGTGTGGATGAGAGATGG + Intronic
1080792918 11:35537379-35537401 CTGTCAATGAGCATGGGAGAGGG - Intergenic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081198618 11:40191345-40191367 CTTAGAGTGTGGACTGGAGAAGG - Intronic
1081994777 11:47356388-47356410 GTGTGAGTGTGCATGTGAGTGGG - Intronic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1082898643 11:58220935-58220957 ATGTGAGTGTGGAAGGTAGTTGG + Intergenic
1083275476 11:61594728-61594750 CTGAGAGTGAGGACGGGGGAGGG + Intergenic
1083691151 11:64409662-64409684 TTGTGAGTGGGGAAGGGAGTGGG + Intergenic
1084318617 11:68360586-68360608 CTGTGACTGTGGCTGGGGCAAGG + Intronic
1084329388 11:68421738-68421760 GTGTGTGTGTGTATGGGGGAGGG + Intronic
1084536549 11:69760798-69760820 CTGTGAGTGTGTCAGGGGGAGGG + Intergenic
1084598163 11:70129508-70129530 GTGTGTGTGTGCATGGGAGCAGG - Intronic
1085733103 11:79016027-79016049 CTGAGAGTGTGGCTGGGGCATGG + Intronic
1085842567 11:80029233-80029255 CTGGGAGTGTGGCTGGCAGATGG - Intergenic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1086494145 11:87385121-87385143 CTCTGCATGGGGATGGGAGAGGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087829383 11:102802494-102802516 CTGTGAATGTGAATTTGAGATGG + Intergenic
1087837673 11:102891085-102891107 ATGGGACTGTGGCTGGGAGATGG - Intergenic
1088510297 11:110566666-110566688 CTATGGGTGTGCATGGGTGAGGG - Intergenic
1089070584 11:115696601-115696623 GTGTGAGTGTGTGTGGGAGAGGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089895795 11:121929021-121929043 ATGTGAGTGTGGAGGAGAGGGGG + Intergenic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090492072 11:127173428-127173450 CCATGAGTGTGGATCGGATAAGG + Intergenic
1090620035 11:128552306-128552328 CTGTGAATGTGGTTGAGTGAAGG + Intronic
1091032641 11:132204770-132204792 CGTTCAGTGTGGATGAGAGAAGG + Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091926090 12:4350906-4350928 TAGTATGTGTGGATGGGAGATGG + Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092045800 12:5431350-5431372 GCTTGAGTGTGGAAGGGAGAGGG - Intergenic
1092081633 12:5721176-5721198 ATGTGAGTGTGCATGGTAGGAGG - Intronic
1093544029 12:20323872-20323894 CTGTGTGTGTGTATGAGAGAGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094213820 12:27920042-27920064 CTTTTAGTGTGGAGGAGAGAAGG - Intergenic
1095169527 12:39018498-39018520 CTGTGAGCTTGGATAGGAAATGG - Intergenic
1095370202 12:41458159-41458181 TTGTGTGTGTGTATGTGAGATGG + Intronic
1095994121 12:48064679-48064701 GTGTGTGTGTGTATGTGAGATGG + Intronic
1096066875 12:48748078-48748100 CTCAGAGTGAGAATGGGAGAGGG - Intergenic
1096122531 12:49097551-49097573 CTGAGAGGGTGGGTGGCAGAGGG - Exonic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096532271 12:52249449-52249471 GTGTGTGTGTGCATGGGAGGAGG + Intronic
1096683832 12:53274755-53274777 CAGTGAGTGTGTATGGTGGAAGG - Intronic
1096829049 12:54300552-54300574 CTGTGAATGGGGATCAGAGAGGG - Intronic
1097059580 12:56272595-56272617 GTGTTTGTGTGCATGGGAGAGGG + Exonic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098493191 12:71106041-71106063 ATGTGAGAGTGGATGTAAGAGGG + Intronic
1099893072 12:88612707-88612729 GTGTCAGTTTGGCTGGGAGATGG - Intergenic
1100021257 12:90072002-90072024 GTGTGTGTGTGTGTGGGAGAGGG + Intergenic
1100743081 12:97616632-97616654 CTGTTTGTGTGGGTGGGAGAGGG - Intergenic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101191701 12:102340512-102340534 GTGTGAGTGTGGATGGGGTAGGG + Intergenic
1101916444 12:108899737-108899759 CTGGGAGTGGGGATGGTAGCTGG + Intronic
1102548011 12:113670523-113670545 CTTTGAGTGAGGATGGGAGTTGG - Intergenic
1102596596 12:113997507-113997529 ATGTGAGTGAGGGTGAGAGAAGG + Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102929012 12:116848556-116848578 TTGTTGGGGTGGATGGGAGAGGG - Intronic
1104017131 12:124968822-124968844 CTGTGAGCTTGGATGGCACAAGG - Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104762818 12:131307540-131307562 CTCTGAGTGTGGACTGGAAAGGG + Intergenic
1104817107 12:131653843-131653865 CTCTGAGTGTGGACTGGAAAGGG - Intergenic
1104902086 12:132194971-132194993 CTGTGAGTCTGGCTGGGGGTGGG + Intergenic
1104981186 12:132573747-132573769 CTGTGAGCCTGGATGGGCCAAGG - Intronic
1105435897 13:20378161-20378183 CAGTGAGTGGGGAAGGGAGGAGG - Intergenic
1105664586 13:22538677-22538699 CTGTGAGTGTGGTAAGGAGGTGG + Intergenic
1106114831 13:26808405-26808427 CTCTGAGGGTGGAAAGGAGATGG - Intergenic
1106597750 13:31161441-31161463 CTGCGAGGGTGGATGGGAGGAGG - Intronic
1107183340 13:37487642-37487664 CAGTGACTGTAGATGGGGGATGG - Intergenic
1107279831 13:38721001-38721023 TTGTGAGTTTGGTTGGGGGAGGG + Intronic
1107434810 13:40372924-40372946 GTTTGAGTGGGGATGGGAGGGGG - Intergenic
1107541274 13:41391428-41391450 CTGGGGGTGTGGGTGGGAGGAGG + Intergenic
1108342935 13:49515445-49515467 GTGTGTGTGTGTATAGGAGATGG - Intronic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1111109942 13:83693957-83693979 TTGAGAGTGTTGATGAGAGATGG + Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111368207 13:87278894-87278916 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1112030816 13:95454649-95454671 GTGTGAGTGTGGAAGGATGAAGG + Intronic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112855463 13:103764450-103764472 CTGTGTGTGTGGCTGGGGGGTGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1115440608 14:33430520-33430542 GTGGGAGTGTAGTTGGGAGAGGG - Intronic
1115841296 14:37473531-37473553 CTGTGTGTGTGAATGGGAGTAGG + Intronic
1116610765 14:47068938-47068960 CTGTGAGAGAGGTTGGCAGAAGG - Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116718474 14:48460056-48460078 CTGTGAGTGTAGCTGTGAGCTGG - Intergenic
1116764194 14:49050771-49050793 CTTTGAGAGTGGAAGGGAGGAGG - Intergenic
1117136642 14:52741440-52741462 GTGTGTGTGTGTATGAGAGATGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117561445 14:56943578-56943600 CTTTGAATGTGGATGCCAGAGGG - Intergenic
1117582800 14:57169780-57169802 ATGTGTGTGTGGATGGGTGGGGG - Intergenic
1118371123 14:65137893-65137915 CAGTGAGTGGGGATGGGCCACGG - Intergenic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119536241 14:75404731-75404753 ATTTGAATGTGGACGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119944880 14:78682684-78682706 CTGTCATTGTGGATGGGATGGGG + Intronic
1120838877 14:89065244-89065266 GGGTGAGCCTGGATGGGAGATGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121305804 14:92906361-92906383 CCTTGAGAGTGGATGGGAGAAGG - Intergenic
1121504012 14:94462420-94462442 CTGAGAGTGAGGATAGGACAAGG - Intergenic
1121535469 14:94687616-94687638 TTGTGAGTGTGGGTGGGGGAAGG - Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1122620506 14:103055042-103055064 CTGTGAGTGTGACTGGGAAGAGG - Intronic
1122805562 14:104254801-104254823 CGCTGAGGGTGGGTGGGAGAAGG + Intergenic
1122957103 14:105075963-105075985 CTGGGAGGGTGGCTGGGAGACGG + Intergenic
1123467588 15:20528213-20528235 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1123469159 15:20537373-20537395 CAGTGAATGTGGAAGGGACAGGG + Intronic
1123650526 15:22472829-22472851 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1123740934 15:23281671-23281693 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1123746064 15:23320887-23320909 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1124278333 15:28344204-28344226 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1124304369 15:28567404-28567426 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1124533245 15:30523870-30523892 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124765412 15:32483774-32483796 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1125285197 15:38085257-38085279 CTGTGTGTGTGGGTGGGTGTGGG - Intergenic
1126100483 15:45115578-45115600 CTGTTAGGGTAGATGGGAAATGG + Intronic
1126336124 15:47588116-47588138 CTAGGAGTGTGTATGGGATAGGG - Intronic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1127333126 15:57957909-57957931 CTGAGAGGGTGGGTGGGAGCGGG + Intronic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129453736 15:75664888-75664910 CTGTGCTTGTGGATGGGATGTGG - Intergenic
1129504669 15:76071466-76071488 CTCCCAGTGTGGGTGGGAGAGGG + Intronic
1130809259 15:87359316-87359338 CTATGACTGTGGATGGGCTATGG - Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131046635 15:89320735-89320757 GTGTTAAAGTGGATGGGAGAGGG + Intronic
1131094571 15:89647358-89647380 GTGTGAGCTTGGACGGGAGAGGG - Intronic
1131664853 15:94559244-94559266 CTTTTAGTATGGATGTGAGATGG - Intergenic
1132026110 15:98405703-98405725 GTGTGTGTGTGTATGAGAGAGGG - Intergenic
1132056549 15:98654963-98654985 CTTTAAGTGGGGATGGGGGAGGG + Intronic
1132186187 15:99803890-99803912 CTGTGAGAGTGGCTGGGGGTAGG + Intergenic
1132568576 16:634370-634392 TTGTGAGGTTGGGTGGGAGACGG - Intergenic
1132607128 16:798313-798335 GTGTGAGTGGGGCTGGGAGTGGG + Exonic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1133244904 16:4441923-4441945 CTGTCAGAGTGGAAGAGAGAGGG + Intronic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135539848 16:23321414-23321436 CTGTGAGTGGGGGTGTGAGCAGG + Intronic
1135627928 16:24012418-24012440 CTCTCAGTGAGGATGGGACATGG - Intronic
1136043563 16:27599028-27599050 CTGGGAGTGTGGATGGCTGGTGG - Intronic
1136073807 16:27804839-27804861 CTGGGATTGGGGACGGGAGAGGG + Intronic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136366469 16:29811475-29811497 CCATGAGTGTGGACGGGGGAGGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1138008278 16:53356922-53356944 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1138282640 16:55783815-55783837 CTCAGAGTGTGGCTCGGAGAGGG - Intergenic
1138483014 16:57316649-57316671 CTGTGAATGAGTATGGGGGAAGG + Intergenic
1138970438 16:62136293-62136315 CTGTGAGTGTTTATGGGGGGGGG + Intergenic
1139332623 16:66205325-66205347 CTGTGAGTTCGGATGGGACAAGG + Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140059150 16:71552916-71552938 CTCTAAGTGCAGATGGGAGAAGG + Intronic
1140341074 16:74162847-74162869 CTGTGTGTGTGGTTGTGAGAGGG + Intergenic
1140906376 16:79412794-79412816 CTCTGGGTGTGAATGGGGGAGGG - Intergenic
1141620268 16:85233652-85233674 GTGTGCGTGTGGATGGGTGGTGG + Intergenic
1142502406 17:340345-340367 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502416 17:340381-340403 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502440 17:340453-340475 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502479 17:340561-340583 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502492 17:340597-340619 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502505 17:340633-340655 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502530 17:340705-340727 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502543 17:340741-340763 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502554 17:340777-340799 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502567 17:340813-340835 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502580 17:340849-340871 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502593 17:340885-340907 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502606 17:340921-340943 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502618 17:340956-340978 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502631 17:340992-341014 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502643 17:341027-341049 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502665 17:341097-341119 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142880643 17:2880203-2880225 ATGGGAGTGTGGGTGAGAGAAGG + Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1144250255 17:13409205-13409227 CTCTTAGTGGGGATGGGTGAGGG - Intergenic
1144533343 17:16061941-16061963 CTGGGAATGTGGTGGGGAGATGG + Intronic
1146791031 17:35750609-35750631 CTGTGACTGTGGATGAGAGAAGG + Intronic
1146807325 17:35875405-35875427 CTCTGAGTGAGGCTGGGAAAGGG - Intronic
1146836801 17:36117556-36117578 ATCTGAGTGTGGGAGGGAGAAGG - Intergenic
1147596774 17:41722941-41722963 CTCTGTGTGTGGGTGGGTGAGGG - Exonic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1149232838 17:54555033-54555055 CAGTGAGTGGGAATGGTAGATGG + Intergenic
1149478683 17:56984549-56984571 CTGTGAGCATCCATGGGAGAGGG - Intronic
1149867388 17:60158239-60158261 CTGTCAGTGAGGGTGGGAGAAGG - Intronic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151487238 17:74408669-74408691 CAGTGAATGAGGATGGGAAAGGG - Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1152018562 17:77768377-77768399 GTGTGAGTGTGTATGGGAGGAGG - Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1153054700 18:934486-934508 CTGTGAGGGAGGCTGGAAGAGGG + Intergenic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153988216 18:10372135-10372157 CTGTGAGGCTGGATGGGCGGTGG - Intergenic
1155205234 18:23552735-23552757 CCGTCAGAGTGGATGGGTGACGG + Intronic
1157718160 18:49903530-49903552 CTGTGAGTGTTCTTGGGTGATGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157991700 18:52504302-52504324 CTGGCAGTGTCAATGGGAGAAGG + Intronic
1158125987 18:54100150-54100172 CTGCCAGTGTGGCTGGGAGAAGG + Intergenic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1159603307 18:70449416-70449438 CTGTGTGTGTGAATGGGAAGGGG - Intergenic
1160409756 18:78667747-78667769 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160409775 18:78667789-78667811 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160409817 18:78667902-78667924 TTGGGAGGGTGGATGGGGGAAGG - Intergenic
1160409833 18:78667939-78667961 GTGGGAGGGTGGATGGGGGAGGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1161051363 19:2165386-2165408 CGGTGCGAGTGGATGGGAGAGGG + Intronic
1161373132 19:3924832-3924854 TCGTGAGTGTGGAAGGGTGAGGG - Exonic
1161525146 19:4750005-4750027 CTGTGAGTGTGGACGTGGGGTGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163856769 19:19708501-19708523 GTGTGGGTTTGGATGGGAAACGG + Intergenic
1165723106 19:38093614-38093636 GTGTGTGTGTGGATATGAGAAGG - Intronic
1166988469 19:46676651-46676673 CTGTGGGTGTTGACGGGAGCAGG - Intronic
1167071969 19:47226981-47227003 TTGTCAGTGTGGAAGGTAGACGG + Intronic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167524107 19:49973000-49973022 CTGTGAGTGTGGCTGGATGGGGG - Intergenic
1167674893 19:50877882-50877904 CTGTGAGGGAGGCTGGGTGAGGG - Intronic
1167966942 19:53155771-53155793 CTGTGAGTGAGGCTGGTACATGG + Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
925307505 2:2860693-2860715 GTGTGAGAGTGGTTGTGAGATGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925916792 2:8612710-8612732 CTCTGAGTGTGGCTTGGAGGTGG - Intergenic
925999274 2:9317149-9317171 GTGAGAGTGTGGATGTGAGTGGG - Intronic
925999281 2:9317202-9317224 GTGTGAGTGTGGATGTGAGTGGG - Intronic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927748205 2:25642217-25642239 GTGTGTGTGTTGATAGGAGAAGG + Intronic
928349331 2:30534263-30534285 GTGTGTGTGTGTTTGGGAGACGG + Intronic
928424327 2:31165679-31165701 TTGAGAGTGTGGTGGGGAGAGGG - Intergenic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
928933790 2:36652934-36652956 TTGTTGGTGTGGATGTGAGACGG + Intergenic
929295285 2:40239568-40239590 CAGTGACTGTGCATGGGAGGAGG - Intronic
929403237 2:41610321-41610343 CTTATAGTGTGGATAGGAGATGG - Intergenic
929545666 2:42854104-42854126 ATGTGTGTGAGTATGGGAGATGG + Intergenic
929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG + Intergenic
929892138 2:45927080-45927102 ATGTGAGCGTGCATGGGACAAGG + Intronic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931632897 2:64317219-64317241 CTGTGAGTGTGTATGGGGGGTGG - Intergenic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932366655 2:71157348-71157370 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
932398707 2:71465399-71465421 CTGAGAGTGAGGTTGGGCGATGG + Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932998913 2:76896191-76896213 TTGTGTGTGTGCATAGGAGATGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934048361 2:88190293-88190315 CTGTGAGGATGGTTGGGAGCAGG + Intergenic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934853478 2:97715421-97715443 CTGTGACTGTAAAAGGGAGATGG - Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935330132 2:101970989-101971011 CCATGAGTGTGTATGGGGGATGG + Intergenic
935788698 2:106571385-106571407 ATGAGAGTGAGGCTGGGAGAAGG + Intergenic
935894804 2:107723662-107723684 CAGTGACTTTGGATGAGAGAAGG - Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936460805 2:112712691-112712713 CAGTGAGTGTGAAAGGGAGAAGG - Intergenic
936783334 2:116061656-116061678 CTATGAATGTGGTAGGGAGAAGG - Intergenic
937018296 2:118627236-118627258 GTGTGCATGTGGATGAGAGAGGG - Intergenic
937028820 2:118721257-118721279 TGGTGAGTGTGGCTGGGATATGG + Intergenic
937290167 2:120777324-120777346 GTGTGAGTGAGTGTGGGAGACGG + Intronic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937766639 2:125668927-125668949 CTGGCAGTGTGGATGGCTGAAGG + Intergenic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938102045 2:128504078-128504100 CTCTGAGGGTGGTTGGGAGATGG + Intergenic
938654924 2:133421596-133421618 CTGTGCCTGTGGCTTGGAGATGG - Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
939106256 2:137952093-137952115 AAGTGTGTGTGGGTGGGAGAGGG - Intergenic
939519139 2:143207465-143207487 GTGTGTGTGTCAATGGGAGAGGG - Intronic
939564302 2:143768528-143768550 GAGTGAGTGTGGTTGGGAGTAGG + Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941404021 2:165066558-165066580 CTGTGTGTGTGTATGTGGGAGGG + Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
942453337 2:176122058-176122080 GTGTGAGTGTGGCAGGGGGAGGG + Intergenic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943912284 2:193584183-193584205 GCCTGAGTGTGGATGGAAGAGGG - Intergenic
946088047 2:217194478-217194500 CTGTGAGTGTGGATTGAACCAGG + Intergenic
946110354 2:217409447-217409469 TTGTGTGTGAGGATAGGAGATGG - Intronic
946226254 2:218265558-218265580 GTGTGAGTGAGGATGGGGAAAGG - Exonic
946543134 2:220707616-220707638 ATGTGGATGTGGATGGGAGTAGG - Intergenic
946756571 2:222953437-222953459 CTGTCAGTGTGGCGAGGAGAGGG - Intergenic
947516209 2:230807213-230807235 GGGTGAGTGTGGGTGGGAGGGGG - Intronic
948049484 2:234968709-234968731 CCGTGAGTGTGGATCGGGGAAGG - Intronic
948188781 2:236042697-236042719 ATGTGAGTGCGGATGGGGGGTGG + Intronic
948437295 2:237962225-237962247 CTGTGTGTGTGTGTGGGAGTGGG - Intergenic
948942671 2:241204017-241204039 CTGTGTGTGCGGATGAGAAAGGG - Intronic
949056167 2:241929157-241929179 CTGCGAGTGGGGGTGGGAGTGGG - Intergenic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1170196918 20:13698560-13698582 CTGTGCTTGTGTATGGTAGATGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171317086 20:24204827-24204849 CTGAGAGTGAGGTTGGGACAAGG - Intergenic
1172368252 20:34365985-34366007 CTGTGTGTGTGGCTGGGTGGAGG + Intronic
1172749433 20:37239775-37239797 CAGGGAGTGGGGGTGGGAGAAGG - Intronic
1173082092 20:39877897-39877919 CTTTGAGAGTTGCTGGGAGATGG + Intergenic
1173104741 20:40123268-40123290 CTGGGAGAGTGGATTGGACATGG - Intergenic
1173347712 20:42216103-42216125 ATGTGAGTGTGGAACGGAGAAGG - Intronic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173888318 20:46481016-46481038 CTGTGTGTGTGGTTGGGGGTAGG + Intergenic
1175826424 20:61938800-61938822 CTGTGAGTTTGGTTTGGACAAGG - Exonic
1175984631 20:62758500-62758522 CTGTGACTGGGGCCGGGAGAAGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176415448 21:6471982-6472004 CTGAGTGTGTTGGTGGGAGACGG + Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177436210 21:21056514-21056536 GTGTGTGTGTGCATGAGAGAGGG + Intronic
1178913213 21:36692996-36693018 GTGGGAGGGAGGATGGGAGATGG + Intergenic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179690948 21:43080315-43080337 CTGAGTGTGTTGGTGGGAGACGG + Intergenic
1180138572 21:45876983-45877005 CTGTGAGTGCGGCTGGCAGCAGG - Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183717499 22:39542187-39542209 CTGTGAGTTTGGGTGGGGGCTGG - Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184150666 22:42636490-42636512 CAGTGAGTGTGGTTCAGAGAAGG + Intronic
1184390562 22:44200992-44201014 CTGTGGCTGTGGCTGGGAGTCGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184885889 22:47344200-47344222 GTGTGTGTGAGGCTGGGAGAGGG + Intergenic
950421789 3:12903745-12903767 CTGGGAGTGGGGATGGGAAGAGG + Intronic
950451945 3:13070455-13070477 CTTTCAGTGTGGAAAGGAGATGG - Intronic
950508055 3:13408007-13408029 CTCTGAGTGTCCATGGAAGATGG - Intronic
950532008 3:13557684-13557706 CTGTCACTGTGGATGGGGCAGGG + Intronic
950566796 3:13774103-13774125 CTGTGAGTGCGCAGGGGTGAAGG + Intergenic
950872967 3:16245234-16245256 GTGGGAGTGAGGATGTGAGATGG - Intergenic
950873431 3:16248964-16248986 ATGTGTGTGTGGATGGGGCATGG + Intergenic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951460741 3:22949080-22949102 ATGTGATTGTGGTTTGGAGATGG - Intergenic
951829335 3:26906996-26907018 CTCTGCGTGTGGTTGTGAGAGGG - Intergenic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952064281 3:29549087-29549109 ATGTGAGGGTGGAATGGAGAGGG - Intronic
952694585 3:36250365-36250387 CAGTGAGTAGGGATGGGACATGG - Intergenic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953461202 3:43082497-43082519 CAGTGTGTGTATATGGGAGAGGG - Intronic
953498683 3:43411945-43411967 CTGTGCCTGTGGATAGGATAGGG + Intronic
953970225 3:47341677-47341699 CACAGCGTGTGGATGGGAGACGG + Intronic
954334567 3:49908823-49908845 GAGTGAGGGTGGATGGGCGAAGG + Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954659396 3:52218903-52218925 CTGTGAGCGTGGGTGGGGGGTGG + Intergenic
954854082 3:53627597-53627619 CTGTGGCTGTGGATGGGTGGGGG + Intronic
954981238 3:54747408-54747430 CTATGGCTGTGGATGGGACATGG + Intronic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
956173618 3:66453056-66453078 CCCTGAGTGAGGATGGGAAATGG - Intronic
956610497 3:71117534-71117556 GTGTTTGTGTGTATGGGAGAGGG + Intronic
956894288 3:73643950-73643972 CTGTGAGTGGGGATGGGACTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957041393 3:75338164-75338186 CGGTGAGTGTGGACAGGGGAGGG + Intergenic
957060720 3:75479350-75479372 CGGGGAGTGGGGCTGGGAGATGG + Intergenic
957606985 3:82413092-82413114 TTGTGAGTGTGGGTGAGAGAGGG - Intergenic
957738988 3:84238267-84238289 CTGTGTGTGTGTATGGGTGGGGG - Intergenic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959328927 3:104977051-104977073 TTCTGAGTGTGGATAGGAGAAGG + Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
961995307 3:131235691-131235713 CTGTGAGTATGAATGGGATAAGG - Intronic
962418912 3:135210005-135210027 CTGTGCCTCTGGATGGGTGATGG + Intronic
962455700 3:135563741-135563763 CTGAGAGGGTTGATGGTAGAGGG - Intergenic
962925884 3:139993090-139993112 TTGTGTGTGTGTATGGGAGGGGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963431383 3:145209281-145209303 CTGTGAATGATGCTGGGAGATGG - Intergenic
963648059 3:147942666-147942688 GTTTGAGGGAGGATGGGAGAGGG + Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
967201566 3:187076611-187076633 CTGTGTTTGTGGATCAGAGAAGG + Exonic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
970421706 4:15911117-15911139 CTGTGAGTCTGTGTTGGAGATGG - Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
970791126 4:19859357-19859379 CTGAGGGTGTGGGTGGGAGGAGG - Intergenic
971724774 4:30296292-30296314 ATGTGATTGTGTGTGGGAGAAGG - Intergenic
973613663 4:52659266-52659288 CTTTCAGTTTGGCTGGGAGAGGG + Exonic
975668509 4:76756633-76756655 CTTTGAGTCTGGATGGGTGCTGG - Exonic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977154710 4:93557343-93557365 ATGTGTGTCTGCATGGGAGACGG - Intronic
977560242 4:98525429-98525451 GAGTGAGTGTGGATGTGTGATGG + Intronic
979685223 4:123504362-123504384 CTGAGACTGTGAGTGGGAGAGGG + Intergenic
980092769 4:128459649-128459671 ATGTGACTGAGAATGGGAGAAGG + Intergenic
980094989 4:128480242-128480264 TTGAGAGTGTTGATGGGAGGAGG - Intergenic
980749679 4:137071831-137071853 CTAGGAGTGGGGATGGGGGAAGG - Intergenic
981011373 4:139928668-139928690 CTGTGTGTCTGGGTGGGAAATGG + Intronic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
982929136 4:161379477-161379499 CAGTGTGTGTGTATGGGGGAGGG + Intergenic
982961991 4:161850890-161850912 CTGTCAGGGTAGGTGGGAGAAGG + Intronic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
984514521 4:180721490-180721512 GGGTGAGTGTGGATGGGTGTGGG + Intergenic
984784392 4:183554256-183554278 GGGTAAGTGTGGATGGGGGAGGG + Intergenic
985181710 4:187272073-187272095 GTGTGAGTGTGGATGAGTGTGGG - Intergenic
985272420 4:188206817-188206839 GAGTGAGTGTGGATGGGTGAGGG + Intergenic
986019212 5:3785485-3785507 ATGTGAATGTGGATGTGAGTTGG - Intergenic
986019258 5:3785896-3785918 ATGTGAATGTGGATGTGAGTTGG - Intergenic
986019275 5:3786060-3786082 ATGTGAGTGTGGATGTGAATGGG - Intergenic
986587796 5:9336552-9336574 CGGTGAGTATGGATTGGACAAGG - Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986806470 5:11312661-11312683 GTGTGAGTGTGCATGTGGGATGG - Intronic
986845185 5:11744082-11744104 CGGTCAGTGAGGATGGGAGCAGG + Intronic
986865121 5:11976947-11976969 CTGGGAGTGTGGGTTGGAGGAGG - Intergenic
986928686 5:12792363-12792385 CTGTAAGTGTGGATGGTATGGGG + Intergenic
987472533 5:18350907-18350929 CTGTGAAAGTGTCTGGGAGAGGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988323836 5:29737172-29737194 CATTGAGCGTGGATGGAAGACGG + Intergenic
988897991 5:35698884-35698906 CTGTGACTGTGGGTGGACGAAGG + Intronic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
991408002 5:66320375-66320397 CTGGCAGTGTTGATGGGATAGGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992179866 5:74185372-74185394 GTGTATGTTTGGATGGGAGAGGG - Intergenic
992634722 5:78716504-78716526 TTGTGTGTGTGGATGGGGGGTGG + Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
993271610 5:85804165-85804187 CTATGTGTTTGGATGGGGGAGGG + Intergenic
994139874 5:96330352-96330374 GTGTCAGTGAGGAAGGGAGAAGG + Intergenic
994176717 5:96719230-96719252 TTGTGAGACTGGATGGGAGTAGG - Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995523398 5:113031688-113031710 CACTGAGTGTGGATAGGAGTGGG - Intronic
995737826 5:115321502-115321524 CTGTGAATGTGGCTGGGCCAGGG + Intergenic
995846376 5:116498554-116498576 CTGTGAGTGTGCATGGGGGGAGG + Intronic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
996645273 5:125807265-125807287 GTGTGTGTGTGTATGAGAGATGG - Intergenic
997266520 5:132497974-132497996 CTGGGAGTTTGGGTGGCAGAGGG + Intergenic
997290921 5:132734356-132734378 CTGTCAGTGTGGATGAGATGAGG - Exonic
997523094 5:134535682-134535704 CTCTGTGGGTGGGTGGGAGAGGG + Intronic
997620959 5:135294602-135294624 GTGTGTGTGTGTATGAGAGAGGG + Intronic
997869906 5:137498255-137498277 GTGTGTGTGTGGTTGGGAGGGGG - Intronic
998150618 5:139755284-139755306 GTGTGAGTGTGGGTGTGAAATGG + Intergenic
998390454 5:141783990-141784012 CTGTGTGTGTGTCTGGGGGAAGG - Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998659954 5:144225190-144225212 TGGGGTGTGTGGATGGGAGAAGG + Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999420566 5:151438730-151438752 CTGGGAGAGTGCATGAGAGATGG - Intronic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1001239962 5:170061110-170061132 AAGTGTGTGTGGATGGGTGAGGG - Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001545654 5:172569114-172569136 CTGGGAGTGTGGATGGGGGCTGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1005790113 6:29291176-29291198 CTGTGAGAGTGGACTGGACAAGG - Intergenic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006683699 6:35814997-35815019 CTGAGAGTGTAGAGGGGTGAGGG - Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007247997 6:40476161-40476183 CCCTGAGTGTGGATGGGGCATGG - Intronic
1007285227 6:40742786-40742808 ATGTGAGTGTGCATTGGGGAAGG - Intergenic
1007418411 6:41705486-41705508 GTGTGAGTGTACATGGGAGTGGG - Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1007922430 6:45622610-45622632 ATGTAAATGTGGATGGTAGACGG - Intronic
1008596124 6:53043750-53043772 ATGGGGGTGTGGATGGGAGGGGG + Intronic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1009994964 6:70887501-70887523 CTGTGAGTGGGGCTGAGTGACGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012893164 6:104919938-104919960 CTGTGCCTGTACATGGGAGAAGG - Intergenic
1013005416 6:106068593-106068615 GTATGACTGTGGATGGTAGAAGG - Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014571933 6:123020067-123020089 CTGTGAGGGTGTTTGGGATAGGG - Intronic
1014742682 6:125164686-125164708 CTGCTAGTATGGTTGGGAGATGG - Intronic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1014952488 6:127573425-127573447 CTGTTATTGAGGATGGGAAAAGG + Intronic
1015156891 6:130106722-130106744 ATGTGAGTCAGGATGGAAGATGG - Intronic
1016243556 6:141958237-141958259 TTTTGACTGTGGATGAGAGAAGG + Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017329805 6:153183147-153183169 CTGAGAGTGAGGATGGAAAAGGG + Intergenic
1017410402 6:154161967-154161989 CTGCGAGTGAGGATGAGAGAGGG - Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017744856 6:157437033-157437055 CTGTGACTGTGCATGTGACATGG + Intronic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1017983368 6:159421915-159421937 CTGTCAGCGTGCATGGGAGCGGG + Intergenic
1018019851 6:159751545-159751567 CTGAGAGTGCTGATGGGAAATGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019057828 6:169235891-169235913 GGGAGAGTGTGGATGGGGGAGGG - Intronic
1019057858 6:169236019-169236041 GAGGGAGTGTGGATGGGGGAGGG - Intronic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1019167326 6:170107306-170107328 ATGTGAGTTTGGGTGGGAGGTGG - Intergenic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019864524 7:3694371-3694393 CTGTGAGTGTCTATGAGAGGAGG - Intronic
1020007070 7:4788721-4788743 CGATGAGTGAGGATGGGAGCGGG + Intronic
1020032243 7:4941055-4941077 CTGTGAGTGGGGTTAGGAGGAGG + Intronic
1020088315 7:5323396-5323418 GAGGGAGTGTGGATGGGAGGTGG - Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021303114 7:18996835-18996857 ATGTGTGTGTGGCTGGGAGGTGG - Intronic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022482257 7:30751964-30751986 GTGTCAGTGTGGCTGGGAGGTGG + Intronic
1023039723 7:36161526-36161548 CCGTGTGTGTGCATGGGGGAGGG - Intronic
1024473641 7:49788671-49788693 CTGTGAGTGTGGGTGTGTGAGGG + Intronic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1027809287 7:82873292-82873314 ACGGGAGTGTGGATGGGGGATGG - Intronic
1029303349 7:99601262-99601284 CCTGGAGAGTGGATGGGAGATGG + Intronic
1029475972 7:100784833-100784855 CTGTGAGTGGGCATGGGAAATGG + Exonic
1029649052 7:101878315-101878337 CAGTGAGTGTGCCTAGGAGAGGG + Intronic
1030124205 7:106139180-106139202 CGGTGAGTTTGGAAGGGAGCAGG + Intergenic
1031084855 7:117292276-117292298 GTGTGAGTGTGGTTGGGAGTAGG - Intronic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1033013036 7:137642960-137642982 GTGTGTGTGTGTATGGGGGATGG + Intronic
1034068678 7:148161540-148161562 TTGTGTGTGTGTATGGGAGGTGG - Intronic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034423249 7:151000033-151000055 GTGTGAGTGTGGATGTGTGTAGG + Intronic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034480058 7:151312905-151312927 GTGTGAGTGTGGATGTGTGTGGG + Intergenic
1034480177 7:151313957-151313979 GTGTGAGTGTGGGTGTGAGATGG + Intergenic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035054500 7:156025274-156025296 GTGTGTGTGTGGATGGGTGTGGG + Intergenic
1035127018 7:156616307-156616329 CTGAGACTGTGGAGGGGTGACGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035469974 7:159103495-159103517 CTGTGTATGTGTCTGGGAGATGG - Intronic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1036190273 8:6663760-6663782 ATGTGTGTGTGTATGGGAGGTGG + Intergenic
1036749376 8:11434339-11434361 CTGGGACTGTGGATGGGAGGGGG + Intronic
1037360350 8:18067711-18067733 CTGTGAGTGTGGGAAGGAAATGG - Intronic
1037674253 8:21040872-21040894 GTGTGTGTGTGCATGAGAGAGGG - Intergenic
1037889807 8:22617959-22617981 CTGTTGGGGTGAATGGGAGAGGG + Intronic
1038336361 8:26648915-26648937 CAGTGAGTGGTGGTGGGAGAGGG - Intronic
1038469286 8:27798850-27798872 CAGGGACTGAGGATGGGAGAGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041718879 8:60958068-60958090 ATGTGAGTGTGGCTGAGATACGG + Intergenic
1042414209 8:68500625-68500647 GTGTGAGTGTGGATGTGTGTGGG - Intronic
1042688124 8:71463644-71463666 CTGTGAGTGTGTGTGTGGGAGGG - Intronic
1043440974 8:80276830-80276852 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1043508746 8:80929449-80929471 CTGCGAGTGAGGATGTGAGGTGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044418337 8:91961660-91961682 CTATGAGTGTGGTGGGGAGGGGG + Intronic
1044932202 8:97261054-97261076 TTGTGAATGTGGGTGGCAGAGGG - Intergenic
1046915160 8:119671991-119672013 CTGTGTGTGTGCGTGGGAGGGGG + Intronic
1047811832 8:128418782-128418804 GGGTGAGTCGGGATGGGAGATGG + Intergenic
1047942878 8:129843219-129843241 CTCTGGGTGTCCATGGGAGATGG - Intronic
1049163925 8:141115342-141115364 GTGGCAGTGGGGATGGGAGAGGG + Intergenic
1049284224 8:141765946-141765968 CTGGACGTGTGGATGGGAGAGGG + Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1052633106 9:31066095-31066117 GTGTGAGTTTTGATGGTAGAGGG - Intergenic
1052981196 9:34450933-34450955 ATGTGAGTGTGCATGCAAGAGGG - Intronic
1053409793 9:37908474-37908496 CTCTGAGTGTTGATAGGAGAGGG + Intronic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057731882 9:97616527-97616549 TGGTGAGTGTGGAAGAGAGAAGG + Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1058447204 9:105064625-105064647 CAGTGAGTGTGGTTGGGGGAAGG + Intergenic
1058553059 9:106136386-106136408 CTGTGAGAATGCATGGGAGGAGG - Intergenic
1058994749 9:110288652-110288674 ATGTGTGTGTGGCTGGGAGTAGG - Intergenic
1059626031 9:116067154-116067176 CTGTGCATGTTGATGGGAGGTGG - Intergenic
1059667561 9:116463204-116463226 CTGAGAGACTGGTTGGGAGATGG - Intronic
1060103159 9:120857456-120857478 CTTTGAGAGAGCATGGGAGAAGG - Exonic
1060147992 9:121268393-121268415 CAAAGAGTGTGGATGGGAGTTGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060229784 9:121818171-121818193 CTGTGAGATTGAATGGGAGGGGG + Intergenic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1060685042 9:125602577-125602599 CTGACAGTCTCGATGGGAGACGG + Intronic
1060944207 9:127560390-127560412 GAGTGAGTGTGGATGGGAGGAGG - Intronic
1060982437 9:127801464-127801486 GTGTGTGTGTGTATGGGGGAAGG + Intronic
1061806184 9:133138968-133138990 CAGTGAGTGTGGGAGGGAGTGGG - Intronic
1061872115 9:133526729-133526751 CTGAGAGTGTGCATGGGGGCTGG - Intronic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1188732499 X:33668261-33668283 GTGTGTGTGTATATGGGAGATGG + Intergenic
1189320095 X:40082650-40082672 CGGTGAGTGAGGGTGGGAGCCGG - Intronic
1189334411 X:40161980-40162002 TTTGGAGTGTGGGTGGGAGAAGG - Intronic
1189756775 X:44280020-44280042 GTGTGTGTGTGTATGGGGGATGG - Intronic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190317126 X:49158220-49158242 CTTGGAGAGTGGATGAGAGATGG + Intergenic
1192072756 X:67958495-67958517 ATGTGTGTGTGGGTGGGGGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192449812 X:71237087-71237109 CTCTCATTGTGAATGGGAGAAGG + Intergenic
1193669733 X:84369515-84369537 CTGTTAGTGGGAATGTGAGATGG - Intronic
1194164696 X:90500897-90500919 CTGTGAGTGTGGATGAACAATGG - Intergenic
1196769586 X:119280703-119280725 CTGAGAGGGAGGATGGGAGGGGG - Intergenic
1196832967 X:119790848-119790870 CTGCTACTGTGGATGGGGGACGG - Intronic
1197527291 X:127578264-127578286 CAGTGAGTGGTGGTGGGAGAGGG - Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1197614978 X:128680853-128680875 CTGTGTGTGTGTTTGGGGGATGG - Intergenic
1197896938 X:131326378-131326400 GTGTGTGTGTGTTTGGGAGAGGG + Intronic
1198018004 X:132631319-132631341 CTGGGAGTGAGGATGGAAAAGGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1199364473 X:146963586-146963608 CTCTGAGTGTGGATGTGGGGAGG - Intergenic
1199663386 X:150076520-150076542 CTGTTAGTGGGAATGGAAGATGG - Intergenic
1199874485 X:151919997-151920019 TTGGGAGTGTGGATGGGAATGGG - Intronic
1200007146 X:153094658-153094680 CAGTGAAGGTAGATGGGAGAGGG + Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200510956 Y:4078691-4078713 CTGTGAGTGTGGATGAACAATGG - Intergenic
1200787029 Y:7269956-7269978 CTGTGTGTGTGTGTGTGAGATGG + Intergenic
1200902063 Y:8442741-8442763 CTGAGAGTGTGATTGGGACAAGG - Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1202110265 Y:21409885-21409907 GTGTGAGTGACGATGGCAGAGGG - Intergenic