ID: 954609771

View in Genome Browser
Species Human (GRCh38)
Location 3:51938095-51938117
Sequence CTTGCTGACGGAGCTGCTCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954609762_954609771 9 Left 954609762 3:51938063-51938085 CCTGCCCATGGCTGGCCTGCCCA 0: 1
1: 0
2: 6
3: 51
4: 354
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609761_954609771 10 Left 954609761 3:51938062-51938084 CCCTGCCCATGGCTGGCCTGCCC 0: 1
1: 0
2: 13
3: 57
4: 414
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609765_954609771 4 Left 954609765 3:51938068-51938090 CCATGGCTGGCCTGCCCACTGGC 0: 1
1: 0
2: 4
3: 61
4: 431
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609767_954609771 -10 Left 954609767 3:51938082-51938104 CCCACTGGCTCACCTTGCTGACG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609758_954609771 26 Left 954609758 3:51938046-51938068 CCAGCACAGGCAGAAGCCCTGCC 0: 1
1: 0
2: 2
3: 41
4: 306
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609763_954609771 5 Left 954609763 3:51938067-51938089 CCCATGGCTGGCCTGCCCACTGG 0: 1
1: 0
2: 5
3: 26
4: 210
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233
954609766_954609771 -6 Left 954609766 3:51938078-51938100 CCTGCCCACTGGCTCACCTTGCT 0: 1
1: 0
2: 0
3: 31
4: 259
Right 954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954609771 Original CRISPR CTTGCTGACGGAGCTGCTCT AGG Exonic