ID: 954609937

View in Genome Browser
Species Human (GRCh38)
Location 3:51939037-51939059
Sequence TACCCCCAGCTCCCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954609937_954609942 10 Left 954609937 3:51939037-51939059 CCTGCTCCTGGGAGCTGGGGGTA 0: 1
1: 0
2: 3
3: 34
4: 387
Right 954609942 3:51939070-51939092 ACTCAGACACAGAGAATCCAAGG 0: 1
1: 0
2: 2
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954609937 Original CRISPR TACCCCCAGCTCCCAGGAGC AGG (reversed) Intronic
900294803 1:1943488-1943510 TGCCACCAGCACCAAGGAGCAGG - Intronic
900815597 1:4841390-4841412 GGCCCTCAGCTCCTAGGAGCTGG - Intergenic
902563643 1:17295485-17295507 TTCCCCAAGCTTCCAGCAGCTGG - Intergenic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
902741396 1:18441017-18441039 TACTCACAGGTCCCAGGAGAAGG - Intergenic
902988535 1:20170614-20170636 AAGCCCCTGCCCCCAGGAGCAGG - Intronic
903220289 1:21865519-21865541 TGCCCCCTTCTCCCAGCAGCAGG + Intronic
903374321 1:22856292-22856314 TATCCCCAGAGCCCAGGGGCAGG + Intronic
903494597 1:23757013-23757035 TAACCCCAGCCCTGAGGAGCCGG + Exonic
903852478 1:26316453-26316475 TCCCCCCAGGCCCCAGGAGTTGG - Intronic
904131794 1:28281001-28281023 CTCTTCCAGCTCCCAGGAGCAGG - Exonic
904404634 1:30278045-30278067 TTCCCTCAGCTGCCAAGAGCAGG + Intergenic
905561990 1:38934540-38934562 TACCTCCACCTCCGAGTAGCTGG - Intronic
908218778 1:61982098-61982120 TGCCCCCACTTCCCAGAAGCAGG - Intronic
908231104 1:62105970-62105992 TAGTCCCAGCTCCCAGGATGAGG + Intronic
910644568 1:89499546-89499568 TTCCCGCAGCTCTCTGGAGCAGG - Intergenic
910890109 1:92009661-92009683 TACCCCAACCCCCCAGTAGCTGG + Intronic
912062292 1:105687536-105687558 TACCCCCTGTTCCCAGGTCCGGG + Intergenic
912414290 1:109497700-109497722 GAGCTCCAGTTCCCAGGAGCAGG + Intronic
914392897 1:147237580-147237602 TTCCCCCAGCTCCATGGAGCTGG + Intronic
915061880 1:153192900-153192922 TACCACCAGTTCCCAGGTGGTGG - Intergenic
916495434 1:165342490-165342512 TCCCCCCAGCCCCCAGAAGAAGG - Intronic
916647108 1:166797151-166797173 TCCCCCCTGCTCCCAGGAGGAGG + Intergenic
917737753 1:177936129-177936151 CCCGCCCAGCTCCCAGGAGTTGG + Intronic
918056605 1:181026767-181026789 TTCCCGCAGCTTCCAGGGGCAGG - Intergenic
920501691 1:206489618-206489640 AACTCCCAGCTCCCAGGCTCAGG - Intronic
921330669 1:214032506-214032528 CACCTCCACCTCCCAGTAGCTGG + Intronic
922079070 1:222277049-222277071 CATCCCCACCTCCCAGTAGCTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924461953 1:244267417-244267439 TCCCCCCAGCACACAGGAGAGGG + Intergenic
924595497 1:245441536-245441558 AACCCTCCCCTCCCAGGAGCCGG - Intronic
1062979538 10:1710518-1710540 TGCCCCCAGCACCCAAGTGCAGG - Intronic
1063455452 10:6179450-6179472 AACCCCCAGCTGCAAGGGGCAGG + Intronic
1064868204 10:19906287-19906309 TACTCACAGATCCCAGGAGAAGG + Intronic
1065633966 10:27711830-27711852 TAATCCCAGCACCCAAGAGCAGG - Intronic
1065909610 10:30290485-30290507 TGCCTCCAGCTCCCAAGAGTAGG - Intergenic
1065932243 10:30490279-30490301 CAACCCAAGCCCCCAGGAGCTGG + Intergenic
1066558827 10:36646311-36646333 TGCCGGCAGCTGCCAGGAGCTGG - Intergenic
1066657905 10:37712313-37712335 TCACCCCAGCCCGCAGGAGCTGG + Intergenic
1067067234 10:43110957-43110979 GACCTCCAGCTCCCAGGAACAGG + Intronic
1067346380 10:45441684-45441706 TACACCCAGGTCCCAGAGGCTGG - Intronic
1069039976 10:63685277-63685299 AACCTCCAGCTCTCAGGAACAGG - Intergenic
1069405185 10:68091474-68091496 AACCTCCAGCTCCCAGGCTCAGG + Intergenic
1070675142 10:78407053-78407075 TCCCGACAGCTCCCAGAAGCAGG + Intergenic
1070773965 10:79099308-79099330 GACCCCATGCTCCCATGAGCAGG + Intronic
1071497811 10:86180706-86180728 TGCCTGCAGCTCACAGGAGCAGG + Intronic
1072541515 10:96401820-96401842 TACCCCCACCTCCCAGGAATGGG - Intronic
1072558217 10:96541912-96541934 CATCCCCAGATCCCAGGAACTGG + Intronic
1074961173 10:118447563-118447585 GTCCCCCAGATGCCAGGAGCAGG + Intergenic
1075652625 10:124139185-124139207 TATCCCCAGCACCCAGCAGAGGG - Intergenic
1075655590 10:124158986-124159008 TAAACCCAGCTACCAGGGGCAGG - Intergenic
1075731223 10:124637933-124637955 AGCCCCCCGCACCCAGGAGCTGG + Intronic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076173227 10:128340666-128340688 CACACTCAGCTCCCAGGTGCTGG + Intergenic
1076477864 10:130765144-130765166 TGCCAGCAGCTACCAGGAGCTGG - Intergenic
1076494112 10:130885595-130885617 CACCCCCAGCTCTGAGGCGCTGG - Intergenic
1076731226 10:132440210-132440232 CACCCCCAGCACACAGGATCTGG + Intergenic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1076871723 10:133197987-133198009 CACTCCCATCTCCCAGCAGCTGG + Intronic
1077056065 11:593781-593803 TGCCCTCTGCTCCCAGCAGCCGG + Intronic
1077229904 11:1454083-1454105 TGCCCCCCACCCCCAGGAGCAGG - Intronic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1077409195 11:2395601-2395623 TACGCCCAGACCTCAGGAGCAGG + Intronic
1077495976 11:2886556-2886578 TCCCACCAGCCCCCTGGAGCTGG + Intergenic
1079937994 11:26641781-26641803 TACCTCCAATTCCGAGGAGCTGG + Intronic
1081390804 11:42526551-42526573 TGCCCACAGCTCCCGGAAGCAGG + Intergenic
1081661338 11:44890100-44890122 TAGCCCCAGCTCTCAGCAGAGGG - Intronic
1081676652 11:44973974-44973996 CAGCCCCAGCAGCCAGGAGCAGG + Intergenic
1081717324 11:45259650-45259672 CATCCCCAGCTCCCAGGAAGAGG + Intronic
1082004607 11:47412577-47412599 CTCCCGCAGCTCCCAGGAGAGGG - Intronic
1082799786 11:57406169-57406191 TAGCCCCAGCACCCAGGACAGGG + Intronic
1083297021 11:61720361-61720383 TGCCCCCAGCTGCCCGGAGGAGG + Intronic
1083484873 11:62977001-62977023 TACCTACTGCTCCCTGGAGCTGG + Intronic
1083796109 11:65017679-65017701 TTGCCCCAGCTCCGATGAGCAGG + Intronic
1083892650 11:65604255-65604277 GGCCCTCAGCTCCCAGAAGCAGG - Intronic
1084434024 11:69127531-69127553 TCCACCCAGCACCCAGGAGGAGG + Intergenic
1084436658 11:69146066-69146088 TACTTACAGTTCCCAGGAGCAGG - Intergenic
1084442581 11:69183438-69183460 TGCCCCCAGCTCCTCTGAGCTGG + Intergenic
1088532630 11:110827411-110827433 TGCCAACAGCTCCCAGAAGCTGG + Intergenic
1088991050 11:114953963-114953985 AACTCATAGCTCCCAGGAGCTGG + Intergenic
1089257334 11:117200793-117200815 TACCCCCAGCTTCCAGTCTCAGG - Intronic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1093281688 12:17203703-17203725 TACCACCTGCTCCATGGAGCAGG - Intergenic
1093290047 12:17308635-17308657 GACCCCCAGTTCCAATGAGCAGG - Intergenic
1093894834 12:24563375-24563397 TACCCCAATCTCCGAGGAGTAGG - Intergenic
1093931140 12:24956099-24956121 TAATCCCAGCTCCCCGGGGCGGG - Intergenic
1095629558 12:44358811-44358833 TACACCAAACTCCCAGGAGTGGG - Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1096241709 12:49963204-49963226 AACCCCCAGCCCCCATAAGCTGG - Intronic
1097084020 12:56454316-56454338 CAGCCACAGCTCCCAGGAGCTGG + Exonic
1097107483 12:56634307-56634329 GGCCCCCAGCTCCCAGGTTCTGG + Intronic
1097269562 12:57765775-57765797 TTCCCCCAGTTCCCAGGATTCGG + Intronic
1098367017 12:69714362-69714384 TATCCCCAGCTCCTAGAATCAGG - Intergenic
1101661355 12:106768290-106768312 TGCCCCCAGCTGAAAGGAGCTGG + Intronic
1102357899 12:112255238-112255260 TACCCCCATTTCCCAGGTTCAGG - Intronic
1102933508 12:116879590-116879612 GACCCCCGGCGCCCGGGAGCCGG + Intronic
1103646202 12:122394764-122394786 TAATCCCAGCTCCCAGGAGGCGG + Intronic
1103663303 12:122539861-122539883 AACCACCAGCTCCCAGGTTCAGG + Intronic
1103970316 12:124666750-124666772 AACTCCCAGCTCCCAATAGCAGG - Intergenic
1104728547 12:131092701-131092723 GACCACCAGGCCCCAGGAGCGGG - Intronic
1105538831 13:21297164-21297186 TGCCACCAGCTGCCAGAAGCTGG - Intergenic
1105799421 13:23890400-23890422 TGCCACCAGCTGCCAGAAGCTGG + Intergenic
1105849627 13:24322638-24322660 TGCCACCAGCTGCCAGAAGCTGG - Intergenic
1106285591 13:28316054-28316076 TATCCCCAGCTCTCAGAAACAGG + Intronic
1106386821 13:29294906-29294928 AAAGCCCAGCTCTCAGGAGCTGG + Intronic
1110544824 13:76744567-76744589 TAACCCCAGATCCCAAGGGCAGG + Intergenic
1110711840 13:78658883-78658905 TACCCCCATCTCCCAGGACGCGG + Intronic
1110762325 13:79244341-79244363 AACCCCCACCTCCCAGGCTCAGG + Intergenic
1111988074 13:95085356-95085378 AACCTCCAGCTCCCAGGTTCAGG - Intronic
1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG + Intergenic
1112595690 13:100804922-100804944 TTCTCCCAGTTCCCAAGAGCTGG - Intergenic
1114556630 14:23565975-23565997 GAACCCCAGCTCACAGGAGAAGG - Intronic
1115353513 14:32422777-32422799 TTGCCCCAGCTCCCAGGAGCTGG - Intronic
1118514268 14:66508774-66508796 CTCCCCCAGGCCCCAGGAGCCGG + Intronic
1119193811 14:72702397-72702419 TATCCCCAGCTCCAAGGAGCAGG - Intronic
1119788684 14:77330574-77330596 TAGCCCCAGCTCCTAAGAGGAGG + Intronic
1120983513 14:90312424-90312446 TACTCCCAGTTCGCAGGATCTGG + Exonic
1120998059 14:90431679-90431701 AACCTCCAGCTCCCAGGTTCAGG - Intergenic
1121276368 14:92670784-92670806 CACAGCCAGCTCCCACGAGCTGG - Intronic
1121652148 14:95566563-95566585 TACCGCCATCCACCAGGAGCTGG + Intergenic
1121763324 14:96463999-96464021 TCATCCCAGATCCCAGGAGCAGG + Intronic
1122802112 14:104236637-104236659 TACTCACAGCTCCCAAGAGGAGG + Intergenic
1122960527 14:105091926-105091948 GAACCCCAGCTCCCAGGGCCTGG + Intergenic
1123003186 14:105307496-105307518 TACTCACAGTTCCCAGGAGGAGG - Exonic
1123924697 15:25096170-25096192 AACCTCCACCTCCCAGGATCAGG - Intergenic
1125899014 15:43328506-43328528 TCCCACCACCTCCAAGGAGCAGG + Exonic
1128125474 15:65189223-65189245 TACCTCCAGCCCCCAAGGGCAGG - Intergenic
1128263575 15:66250227-66250249 TACCCCTGGCAACCAGGAGCTGG + Intronic
1128374772 15:67066665-67066687 CAGCCCCAGCTCCCCGGAGTGGG - Intronic
1128549968 15:68591674-68591696 GACACCCAGCTCCCAGGCACAGG - Intronic
1128636190 15:69303962-69303984 TTCCCCCAGCTCCAAGGTTCAGG - Intronic
1129198617 15:73985472-73985494 TACCTCCAGCCCCCAGGCCCTGG + Exonic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1131510971 15:93049250-93049272 TACCCCGAGCCCCCAGCACCAGG - Intronic
1131890275 15:96965120-96965142 TCCCTCCTGCTCTCAGGAGCCGG + Intergenic
1132227111 15:100151118-100151140 TACCTCCTGCCCCCAGCAGCAGG - Intronic
1132356005 15:101171750-101171772 AACCTCCACCTCCCAGGATCAGG - Intergenic
1132687937 16:1170093-1170115 TACAGCGAGCTCCCAGCAGCTGG + Intronic
1133058184 16:3157969-3157991 CACCTGCAGCTCCCGGGAGCGGG + Intergenic
1133264414 16:4574843-4574865 TACCCTCAGCACCCAGGACCCGG - Intronic
1133422201 16:5655394-5655416 GACCTCCACCTCCAAGGAGCAGG - Intergenic
1133477140 16:6134497-6134519 TTCCCCGAGCTCACAGGATCAGG - Intronic
1133816492 16:9201296-9201318 AACCCCCACCTCCCAGGTTCAGG - Intergenic
1134392360 16:13831372-13831394 TACTCACAGATCCCAGGAGAAGG - Intergenic
1134673832 16:16075547-16075569 AACCTCCATCTCCCAGGCGCAGG - Intronic
1135179853 16:20263282-20263304 TACCCACAGTTCCCAAGAGGAGG + Intergenic
1137272510 16:46911474-46911496 TCCCCCACACTCCCAGGAGCTGG - Intronic
1138216053 16:55206544-55206566 GACCACCTGCTGCCAGGAGCGGG - Intergenic
1138449757 16:57086664-57086686 TACCCCCCGCCCCGAGTAGCTGG - Intergenic
1139274745 16:65717006-65717028 CACCACCAGCTCACAGCAGCAGG + Intergenic
1139312028 16:66035403-66035425 CACACTCAGCTCCCAGGAGGTGG - Intergenic
1139330060 16:66181201-66181223 TAACCCCAGCTCCCAGAACATGG - Intergenic
1140204833 16:72925223-72925245 TTCCCCCACTTCCCAGAAGCTGG + Intronic
1140411447 16:74743461-74743483 TCCCCCTGTCTCCCAGGAGCAGG - Intronic
1140861912 16:79025549-79025571 CACCCCCAGATACCAGGAGAGGG + Intronic
1141679788 16:85537367-85537389 GTCACCGAGCTCCCAGGAGCGGG - Intergenic
1141763670 16:86045055-86045077 TGCCTGGAGCTCCCAGGAGCTGG + Intergenic
1142212728 16:88816169-88816191 TTCCCCCAGTGCCCAGGAGATGG + Intronic
1142238266 16:88933011-88933033 TCCCTCGAGCTCCCAGGACCTGG - Intronic
1142468158 17:147613-147635 GACCCCCAACTCCCAGGCGTGGG + Intronic
1144501760 17:15794032-15794054 GACCCCCACCCCCCAGCAGCTGG + Intergenic
1144761822 17:17711413-17711435 TCCTCCCAGCTCCCCGGAGTTGG + Intronic
1144889327 17:18484961-18484983 TTCCCCCACCTCCCAGCACCAGG + Intronic
1144962271 17:19051594-19051616 TGCCCCCAGCTCCCAGTGGGAGG + Intergenic
1144972890 17:19122926-19122948 TGCCCCCAGCTCCCAGTGGGAGG - Intergenic
1145142882 17:20459335-20459357 TTCCCCCACCTCCCAGCACCAGG - Intronic
1145163936 17:20596696-20596718 GACCCCCACCCCCCAGCAGCTGG + Intergenic
1146485679 17:33240664-33240686 TACCCCAGGCAGCCAGGAGCGGG + Intronic
1146925100 17:36739099-36739121 TACCCCCAGCTCCCTGTTTCTGG - Intergenic
1147864939 17:43545855-43545877 TCCCACCTGCTCCCAGGAGCCGG + Intronic
1148242998 17:46012502-46012524 TGCCCCCAGATGCCAGGGGCTGG - Intronic
1150219263 17:63486899-63486921 TACCCCCAGGCCCCATGGGCTGG - Intronic
1150225470 17:63522639-63522661 TACCCCCTCCTCTCAGGACCAGG + Intergenic
1150468867 17:65418735-65418757 CAAGCCCTGCTCCCAGGAGCAGG - Intergenic
1151957286 17:77386703-77386725 TTCCCCCAGCCCCCTGGGGCAGG - Intronic
1152141562 17:78540292-78540314 TACCCCCAGCACTCAGCAGTAGG + Intronic
1152656988 17:81524329-81524351 TACCCCCAGCCCCCTGGTCCAGG - Intergenic
1152937766 17:83150458-83150480 AACCCCAGGCTCCCAGGAGCAGG + Intergenic
1156530028 18:37806150-37806172 CACACCAAGCTCCCAGGGGCAGG - Intergenic
1157859121 18:51125172-51125194 TACCCACAGTTCCCAAGAGGAGG + Intergenic
1160045788 18:75386187-75386209 TGCCCCCATCTCCCAGGATAGGG + Intergenic
1160920719 19:1519006-1519028 AACCCCAGGCTCCCAGGAGAAGG + Intergenic
1160946706 19:1647121-1647143 CACCCCTAGCACCCAGGAGCTGG - Intronic
1161764919 19:6201917-6201939 AACCTCCACCTCCCAGTAGCTGG - Intergenic
1162124644 19:8492913-8492935 AACCTCCAGCTCCCAGGTTCCGG - Intronic
1162344058 19:10109672-10109694 CAACCCCGACTCCCAGGAGCTGG + Exonic
1162404865 19:10467580-10467602 GACCCCCCGCCACCAGGAGCTGG - Exonic
1162965799 19:14155509-14155531 GGCCCCCAGCGCCCAGGATCTGG + Exonic
1163618273 19:18342293-18342315 TAGGCCCAGTTTCCAGGAGCAGG - Intronic
1163818500 19:19482614-19482636 TACCCCCAGTTCCCAGTACAGGG - Intronic
1164674956 19:30094823-30094845 TACTCCCAGCTCAGAGGGGCTGG - Intergenic
1164705216 19:30314551-30314573 CAGCACCAGCTCCCAGGATCTGG + Intronic
1165333456 19:35154142-35154164 GACTCCCGGATCCCAGGAGCTGG - Exonic
1165420516 19:35719952-35719974 CACCCCAAGCACCCCGGAGCCGG + Exonic
1165448326 19:35868795-35868817 TTCCCCCATCCCCCAGGACCCGG - Intronic
1166774076 19:45302052-45302074 GTCCCACATCTCCCAGGAGCTGG - Intronic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
1167825569 19:51969972-51969994 AACCTCCGCCTCCCAGGAGCAGG + Intronic
1168239450 19:55081880-55081902 TACCCCCAGCCGCCCGGCGCCGG - Exonic
925424456 2:3737110-3737132 TACCCCCAGGTGCCAGGCCCTGG + Intronic
926801879 2:16666026-16666048 TGCTCTCTGCTCCCAGGAGCTGG + Intronic
927202402 2:20586146-20586168 CACCTCCTCCTCCCAGGAGCCGG + Intronic
929841228 2:45466025-45466047 TATCTTCAGCTCCCAGGACCTGG - Intronic
929976029 2:46635823-46635845 TACCCCCAGCTCTCAGGAATGGG + Intergenic
930105384 2:47635055-47635077 TACCACAAGCTCCCAGTATCTGG - Intergenic
930189304 2:48441166-48441188 CACCTGCAGCTCCCAGGAGATGG + Intronic
930752746 2:54948599-54948621 CTCCCCCTGCTCCCAGGAGAAGG + Intronic
931326261 2:61227627-61227649 AACCCCCACCTCCCAGGTTCAGG - Intronic
932251066 2:70244391-70244413 TATCCCCAGTTCCCAGAAGACGG + Intronic
932272597 2:70423911-70423933 TACCCCCACATCCCAGTAGTAGG + Intergenic
932893852 2:75619558-75619580 TACTCGCAGCTCCCAAGAGAAGG - Intergenic
933671042 2:85007520-85007542 CACCTCCAGCTCCCAGGAACAGG + Intronic
934819564 2:97360389-97360411 TACCTTCAGCTGCCAGGAGGTGG - Intergenic
937522989 2:122734393-122734415 TTCACCCAGCTCTCAGGAGCAGG - Intergenic
937540442 2:122945149-122945171 TTCCCCCAACTCCCAGGCTCTGG - Intergenic
937832365 2:126437802-126437824 TACCCACAGATCCCAAGAGAAGG + Intergenic
938232568 2:129674313-129674335 TACCCCCTGCTCTCAGGAAATGG - Intergenic
939971918 2:148671530-148671552 AACCCCCACCTCCCAGGTTCAGG - Intronic
940799166 2:158114342-158114364 TAGCCCCAGGTACCAGGAGTGGG - Intronic
941104220 2:161333947-161333969 AACCTCCACCTCCCAGGTGCAGG - Intronic
944310216 2:198224843-198224865 TGCCCCCATCCCCCAGGGGCTGG + Intronic
944641815 2:201734609-201734631 TACCTCCGTCTCTCAGGAGCAGG - Intronic
945198657 2:207260441-207260463 TAACCCCAGATCCCATGAGGTGG + Intergenic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
946096520 2:217279195-217279217 TACTCACAGCTCACAGGAGGAGG + Intergenic
947915337 2:233828801-233828823 CACCCTCAGCTCCCGGGACCTGG - Intronic
948689307 2:239691886-239691908 GCCCCCCACCTTCCAGGAGCAGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1169266732 20:4171687-4171709 AACCCCCAGCTCCCTGCACCTGG - Intronic
1171035113 20:21707748-21707770 TCTCCCCAGCTGCCAGCAGCTGG + Intronic
1171188609 20:23142011-23142033 TGCACGCAGCTCCCAAGAGCTGG + Intergenic
1172122751 20:32608313-32608335 TGCCCCCATCTCCCTGGAGGTGG + Exonic
1172613706 20:36269326-36269348 GGCCCCCAGCTGCCAGGACCAGG + Intronic
1172773234 20:37393393-37393415 TCTCACCAGCTCCCAGGAGCGGG + Intronic
1173584956 20:44175586-44175608 TGGGACCAGCTCCCAGGAGCAGG + Intronic
1173774944 20:45697464-45697486 AACCTCCATCTCCCAGGTGCTGG + Intronic
1173900673 20:46586396-46586418 TTTCCCCAGCTCCCAAGTGCTGG + Intronic
1173932555 20:46832910-46832932 AGGTCCCAGCTCCCAGGAGCAGG + Intergenic
1174152049 20:48492741-48492763 GTCCGCAAGCTCCCAGGAGCTGG - Intergenic
1176003540 20:62846355-62846377 CTGCCCCAGCTCCCAGGAGACGG - Intronic
1176197497 20:63844225-63844247 TCTGCCCAGCTCCCAGGACCAGG - Intergenic
1176239322 20:64068603-64068625 CACCCCCAGCTCCCAGCTGCAGG - Intronic
1176380625 21:6110797-6110819 TGCCCCCAGCGCCCGGGAGGGGG + Intergenic
1178977232 21:37230715-37230737 TGCCCCGAACTCCCGGGAGCCGG - Intronic
1179078003 21:38142418-38142440 TACTCACAGTTCCCAAGAGCAGG + Intronic
1179624965 21:42643836-42643858 GACCACCTGCTCCCATGAGCAGG - Intergenic
1179628206 21:42660320-42660342 TCCCTCCAGCTTCCAGGAGCAGG + Intronic
1179635388 21:42705433-42705455 TGCCCTCGGCTGCCAGGAGCTGG + Intronic
1179742847 21:43427443-43427465 TGCCCCCAGCGCCCGGGAGGGGG - Intergenic
1179827591 21:43975650-43975672 TGCTCCCAGCGCCCAGGAGGGGG - Intronic
1180163371 21:46007709-46007731 TTCCCACTCCTCCCAGGAGCTGG + Intergenic
1180784047 22:18537091-18537113 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1180985510 22:19901849-19901871 TACCCCCAGGTCCTGTGAGCTGG - Intronic
1180995509 22:19963368-19963390 TGTCCCCAGCCCCCAGGACCTGG - Intronic
1181172008 22:21015178-21015200 TGCCCGCAGCTAGCAGGAGCTGG + Exonic
1181177298 22:21045022-21045044 TGCCCGCAGCTAGCAGGAGCTGG - Intergenic
1181240948 22:21476443-21476465 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1182005475 22:26956020-26956042 AACCTCCAGCTCCCAGGTTCAGG - Intergenic
1182027100 22:27128739-27128761 GACCCCAAGCCCCCAGGACCAGG - Intergenic
1182116920 22:27761921-27761943 TGCCCCCAGCTCCTGGCAGCCGG - Intronic
1182964644 22:34509660-34509682 TACACCCAGCTCTCAGGGGAGGG + Intergenic
1183037293 22:35149999-35150021 TTCCCCCAGCTGCCAGGATTGGG + Intergenic
1183489788 22:38110266-38110288 AACCCCCAACTCCCAGATGCTGG - Intronic
1183541034 22:38429582-38429604 TTCCCACACTTCCCAGGAGCTGG + Intronic
1183773455 22:39946860-39946882 AATCCCCAGATGCCAGGAGCAGG - Intronic
1183908132 22:41058327-41058349 CACCTCCACCTCCAAGGAGCTGG + Intergenic
1184611063 22:45603537-45603559 CACCTCCAGCTCCCATTAGCTGG - Intergenic
1185150834 22:49163127-49163149 TAGCACCAGCTCCAAAGAGCCGG - Intergenic
949876397 3:8628710-8628732 GGCCCGCAGCTCCCAGAAGCTGG + Intronic
950181624 3:10917683-10917705 GTCCCCCCGCTCCCAAGAGCAGG + Intronic
950285211 3:11739413-11739435 TGGCTCCAGCTCCCAGGGGCTGG + Intergenic
950378012 3:12587912-12587934 TCCTCCCACCTCCCAGTAGCCGG + Intronic
950425081 3:12920833-12920855 TACTCTGAGCTCCCGGGAGCTGG - Intronic
950488227 3:13285356-13285378 GACAGCCAGCTCCCCGGAGCTGG + Intergenic
950488229 3:13285361-13285383 AACCTCCAGCTCCGGGGAGCTGG - Intergenic
952774158 3:37028574-37028596 AACCCTCAGATCCCAGCAGCTGG - Intronic
953093153 3:39749572-39749594 TACCTCCAACTCCTATGAGCAGG - Intergenic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
955359183 3:58258223-58258245 AACCTCCACCTCCCAGGATCAGG - Intronic
955722172 3:61894187-61894209 TCGCCTCAGCTCCCAGTAGCTGG - Intronic
957369376 3:79272552-79272574 TTCTCCCATCTCCCAGCAGCAGG + Intronic
958784367 3:98581602-98581624 TCCCCCCAGTTCCCATCAGCTGG + Intronic
959060787 3:101614376-101614398 TCCCACCAGCTCCCAGGTGGAGG - Intergenic
959583243 3:108003131-108003153 CATCCCCAGCTCCCAGTAGCAGG + Intergenic
960769825 3:121181232-121181254 TACCTCCACCTCCCAGGTTCAGG - Intronic
960813938 3:121654136-121654158 ACCTCCCACCTCCCAGGAGCAGG - Intronic
961511785 3:127407923-127407945 TACCCCCACCTTCCAAAAGCCGG - Intergenic
962733532 3:138304372-138304394 TACTCCCAAGTCCAAGGAGCAGG + Intronic
966629428 3:182056147-182056169 TACCTCCACCTCCCAGTAGCTGG + Intergenic
967879196 3:194287195-194287217 CACCCCCAGCCCCAAGGAGTGGG - Intergenic
968002931 3:195220071-195220093 TCCCCCCAGCTCCCAGCATCAGG - Intronic
968150876 3:196335697-196335719 GGCGCCCTGCTCCCAGGAGCAGG - Intronic
968341567 3:197960167-197960189 TACCCCCAGCGGCGAGGGGCGGG + Intergenic
968621531 4:1605436-1605458 TGCACCCAGCTTCCAGGGGCTGG + Intergenic
968786562 4:2626291-2626313 CTTGCCCAGCTCCCAGGAGCCGG - Intronic
968817101 4:2827870-2827892 TCCTCCCACCTCCCAGGAGGAGG + Intronic
968920748 4:3521178-3521200 TTCCCCCAGCCCCCAGGAAAGGG - Intronic
969663310 4:8543119-8543141 TTCCCCCAGGCCCCTGGAGCTGG + Intergenic
971537177 4:27767842-27767864 AATCCCCAGCTCCCAAGAGGTGG - Intergenic
973812153 4:54581777-54581799 AACCCCCACCTCCCAGGTTCAGG - Intergenic
974385638 4:61200449-61200471 TCGCTCCAGTTCCCAGGAGCGGG + Intergenic
980073730 4:128270836-128270858 TACCCCCACCTCCCCTGATCAGG + Exonic
983525649 4:168757987-168758009 AACCTCCAGCTCCCAGGTTCAGG - Intronic
984122136 4:175758809-175758831 TACCTCCAGTGCCCAGGAGGCGG + Intronic
985640572 5:1061605-1061627 TGCTCCCAACTCCCATGAGCCGG - Intronic
985684388 5:1274155-1274177 GTTCCCCAGCCCCCAGGAGCTGG + Intronic
986346532 5:6840560-6840582 AACCTCCAGCTCCCAGGACCAGG - Intergenic
986709923 5:10481278-10481300 TACTCCCAGTTCCCAGGAGGAGG + Intergenic
987386625 5:17336227-17336249 TATCTCTAGCTCCCAGGAGTGGG - Intergenic
987389204 5:17360371-17360393 GTACCCCAGCTCCAAGGAGCTGG + Intergenic
988614722 5:32764347-32764369 TACCCCCTGGCCCCAGAAGCAGG - Intronic
989195124 5:38708925-38708947 AACCCCCAGCTTCTAGGAGAGGG - Intergenic
991203488 5:64021666-64021688 TACCTTCAGCTCCCTGAAGCTGG + Intergenic
992826881 5:80558757-80558779 TCCCCCCAGGTCCCCTGAGCAGG - Exonic
993877789 5:93328242-93328264 TACCCTCATCTACCAAGAGCAGG + Intergenic
997210619 5:132074705-132074727 TGCCCCCAGCCCCCAGGAGTAGG - Intronic
997527792 5:134564626-134564648 CACCTCCTGCTGCCAGGAGCTGG + Intronic
999366601 5:151027614-151027636 TTCCCCAAGAGCCCAGGAGCAGG - Intronic
999759650 5:154690666-154690688 TACCCCCAGCTGCGGAGAGCAGG + Intergenic
999910739 5:156195952-156195974 AACCTGCAGCTCTCAGGAGCGGG - Intronic
1001065874 5:168534761-168534783 TCCCCCCAGCTCCCAGCACAGGG - Intergenic
1001178648 5:169497267-169497289 AACCCCCACCTCCCATGAGTTGG - Intergenic
1001933113 5:175687099-175687121 GTCCTCCAGCCCCCAGGAGCAGG + Intergenic
1002213384 5:177611344-177611366 TCCCACCAACTCCCAAGAGCTGG - Intergenic
1002692421 5:181059504-181059526 CAGCCCCAGCACCCAGTAGCCGG - Exonic
1003251094 6:4429754-4429776 TACTCACAGTTCCCAGGAGGAGG - Intergenic
1003636957 6:7841001-7841023 TACTCCAAGCTCCGAGGACCTGG + Intronic
1004224791 6:13775561-13775583 TACCCCAGCCTCCCAAGAGCTGG - Intergenic
1004385631 6:15170398-15170420 CAGCCCCAGCTCAGAGGAGCTGG + Intergenic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1006633100 6:35443373-35443395 GACCCCCAGCCCCCTGGAGTGGG + Intergenic
1006816335 6:36852915-36852937 TCTCGCCAGCTCCCAGGAGATGG - Intergenic
1006898272 6:37484353-37484375 TGCCCCCAGCGCCCAGAAGGTGG + Intronic
1006916198 6:37595306-37595328 TTCCCCCAACTCCTAGGAGCAGG - Intergenic
1007090629 6:39182625-39182647 AACCACCAGCTCCCGTGAGCTGG + Intergenic
1007344900 6:41222295-41222317 TTCCCCCAGCAGCCACGAGCAGG + Intergenic
1007773307 6:44208470-44208492 TACCCCCAACTCCCTGGCCCTGG + Intergenic
1008219287 6:48836046-48836068 TACCCCCAACTCCCACAACCAGG - Intergenic
1008596438 6:53047089-53047111 TAGCCCCAGCCCCAAGAAGCAGG + Intronic
1011822726 6:91271941-91271963 AACCCCAGGCTCCCAGGCGCAGG - Intergenic
1012930630 6:105312692-105312714 TACACTGAGCTCCCAGGGGCAGG + Intronic
1016285959 6:142473666-142473688 TGGCCACAGCTTCCAGGAGCTGG - Intergenic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1017692450 6:156980399-156980421 TACCTCCACCTCCCAGGTTCAGG - Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019656176 7:2197349-2197371 TATCCCCAGCACCCAGCACCAGG + Intronic
1019815173 7:3194715-3194737 TACTCACAGTTCCCAGGAGGAGG + Intergenic
1019923188 7:4175591-4175613 TTCCACCAGCTCCCAGTTGCGGG - Intronic
1020041196 7:5003088-5003110 TACCTCCACCTCCCAAGTGCTGG - Intronic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1023310442 7:38881192-38881214 TCCCCCCAGCTTCCAGGGGAGGG - Intronic
1023857151 7:44191300-44191322 AACCACCATCTCCCAGGACCCGG - Intronic
1026902175 7:74043362-74043384 TACCCCAAGATCCCGGGAGAAGG - Intronic
1027197879 7:76043571-76043593 TACCTCCAGTTCCCATGATCAGG - Intronic
1032083706 7:128872839-128872861 AAACTCCAGCTCCCAGGATCTGG - Intronic
1032499687 7:132391151-132391173 TACCAGCAGCTGGCAGGAGCAGG + Intronic
1033302144 7:140196120-140196142 CACCCCCAGCTCCTAGAAGAGGG - Intergenic
1033534871 7:142302918-142302940 TACCCCCAGCACCAAGGACTGGG + Intergenic
1034015798 7:147584871-147584893 TATCCTCAGCTCCCAGGATCAGG + Intronic
1034078632 7:148256661-148256683 GAGCCCCAGCTCCCATGCGCAGG + Intronic
1036778690 8:11631041-11631063 TATCCCCAGCTCCCAGCACCAGG + Intergenic
1038816268 8:30908036-30908058 TACCCCCTCTACCCAGGAGCTGG + Intergenic
1040551992 8:48444923-48444945 TACCTCCTGCTCCCTGGAGGGGG + Intergenic
1041111776 8:54489605-54489627 AACCTCCAGCTCCCAGGTTCAGG + Intergenic
1045006190 8:97918763-97918785 TACCCACTGCTCCCAGTAGGTGG - Intronic
1045011681 8:97964151-97964173 ACCTACCAGCTCCCAGGAGCTGG - Intronic
1046431794 8:114136195-114136217 CACCCCCAGCCCCTAGCAGCAGG - Intergenic
1047001789 8:120580514-120580536 TTCCCCCAGCTCCCATGAGCAGG + Intronic
1047614962 8:126556480-126556502 TGCGCCCAGCTCCGAGGAGGAGG - Exonic
1049199115 8:141331290-141331312 AAAACCCAGCTCCCAGGGGCTGG - Intergenic
1049248432 8:141575323-141575345 TACCCCCATGGCCCAGGATCAGG - Intergenic
1051141995 9:13987943-13987965 CACGTCCAGCTGCCAGGAGCTGG - Intergenic
1051365206 9:16316960-16316982 GAGCCTCAGCTCCCAGGAGAAGG - Intergenic
1053625418 9:39865939-39865961 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1053879444 9:42577281-42577303 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1053893214 9:42717056-42717078 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1054218470 9:62384750-62384772 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1054232246 9:62524416-62524438 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1056788566 9:89610680-89610702 CAGCCTCTGCTCCCAGGAGCTGG + Intergenic
1056835413 9:89951260-89951282 CACTTCCAGCTCCCAGGAGTGGG + Intergenic
1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG + Intergenic
1057139119 9:92716195-92716217 TGTCCCCACCTGCCAGGAGCCGG + Intronic
1057371747 9:94480015-94480037 TCCCCCCACCACCCAGGTGCCGG - Intergenic
1058711299 9:107681767-107681789 CACCCTCATCTCCCAGGAGAGGG + Intergenic
1060140634 9:121206829-121206851 AACCTCCACCTCCCAGGCGCAGG + Intronic
1060838693 9:126777690-126777712 CTCCCCCAGCTCCCAGGAGGGGG - Intergenic
1061058043 9:128234740-128234762 CTCCCCCAGCTCCCGGCAGCTGG + Intronic
1061278529 9:129583677-129583699 AACCCCCAACCCCCAGGAGCTGG + Intergenic
1061513036 9:131072465-131072487 TACCCCCATTTTCCAGGTGCAGG - Intronic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1062031153 9:134362609-134362631 CATGCCCAGCTCCCAGGAGTAGG - Intronic
1062468047 9:136690148-136690170 TGCCCTCAGCTACCAGGGGCAGG + Intergenic
1185504307 X:620085-620107 TCCCCCCAACTCCAAGGAACGGG - Intergenic
1185614778 X:1414179-1414201 CACCCGGAGCCCCCAGGAGCTGG + Intronic
1185614820 X:1414374-1414396 TTCCCCCAGCTGCGAGGAGAAGG + Intronic
1185698866 X:2215363-2215385 TGCCTGCAGCCCCCAGGAGCTGG + Intergenic
1185704961 X:2260060-2260082 TGCCCGGAGCCCCCAGGAGCTGG - Intronic
1185758752 X:2673358-2673380 TGCCTGCAGCCCCCAGGAGCTGG + Intergenic
1185822738 X:3220424-3220446 TGCCTGGAGCTCCCAGGAGCTGG - Intergenic
1186067663 X:5783560-5783582 CACCTGAAGCTCCCAGGAGCTGG - Intergenic
1186529620 X:10282125-10282147 TACAGCCAGAGCCCAGGAGCTGG - Intergenic
1187380214 X:18794789-18794811 TTCCCCCAGCTCCCAGTAGAGGG - Intronic
1187885075 X:23881864-23881886 AACCTCCACCTCCCAGGTGCAGG - Intronic
1188372800 X:29389272-29389294 TACCTCCACCTCCCAGGTTCAGG - Intronic
1189004725 X:36983797-36983819 TGGCCCCTGCTCCCAGGAGATGG - Intergenic
1189044290 X:37574013-37574035 TGGCCCCTGCTCCCAGGAGATGG + Intronic
1189197759 X:39166380-39166402 TACCCAGAGCTGCCAGCAGCAGG - Intergenic
1189772416 X:44439404-44439426 TTCCCCCAGCTCCCCAGAGGAGG - Intergenic
1192148075 X:68694941-68694963 TACCCCCAAGTCCCAGGGCCTGG + Intronic
1192313252 X:70033467-70033489 TACCTCCAGCTCCCCGCTGCGGG - Exonic
1192329112 X:70159972-70159994 CACCCCCACCTCCCTGGATCTGG - Intronic
1196164519 X:112523964-112523986 CTTCCCCAGCCCCCAGGAGCAGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198118679 X:133569442-133569464 TGTCCCCAGCTTCCAGGAACTGG - Intronic
1198220989 X:134602050-134602072 TATCCCCAGCTGCCAGAAGAAGG - Exonic
1199714313 X:150495509-150495531 TACCTCCAGTTCCCAGGTGTAGG + Intronic
1199819870 X:151433665-151433687 AACCTCCACCTCCCAGGATCAGG - Intergenic
1199849011 X:151711964-151711986 TACCAGCTGCTTCCAGGAGCAGG + Intergenic
1200182492 X:154159293-154159315 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200188146 X:154196407-154196429 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200193796 X:154233547-154233569 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200199551 X:154271351-154271373 TGCCCTCAGCACCCAGGAGGAGG + Exonic
1201231645 Y:11870701-11870723 TACCCCAAGCTGCCAGCAGCAGG - Intergenic
1202109573 Y:21406095-21406117 GGCGCCGAGCTCCCAGGAGCGGG + Intergenic