ID: 954610290

View in Genome Browser
Species Human (GRCh38)
Location 3:51941568-51941590
Sequence TTCCCTCAGAACCCCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954610272_954610290 18 Left 954610272 3:51941527-51941549 CCAGACCACCCTGGCATTGACCA 0: 1
1: 0
2: 0
3: 15
4: 133
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610276_954610290 10 Left 954610276 3:51941535-51941557 CCCTGGCATTGACCAAGGGCCCC 0: 1
1: 0
2: 1
3: 13
4: 199
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610277_954610290 9 Left 954610277 3:51941536-51941558 CCTGGCATTGACCAAGGGCCCCC 0: 1
1: 0
2: 3
3: 14
4: 164
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610275_954610290 13 Left 954610275 3:51941532-51941554 CCACCCTGGCATTGACCAAGGGC 0: 1
1: 0
2: 0
3: 18
4: 110
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610281_954610290 -10 Left 954610281 3:51941555-51941577 CCCCCCCCCTCGGTTCCCTCAGA 0: 1
1: 0
2: 1
3: 45
4: 231
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610280_954610290 -9 Left 954610280 3:51941554-51941576 CCCCCCCCCCTCGGTTCCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 330
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253
954610279_954610290 -2 Left 954610279 3:51941547-51941569 CCAAGGGCCCCCCCCCCTCGGTT 0: 1
1: 0
2: 0
3: 8
4: 151
Right 954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954610290 Original CRISPR TTCCCTCAGAACCCCAGGAA TGG Intronic
900310522 1:2031242-2031264 CTCCCTCAGTACCCCAGACATGG - Intergenic
901170192 1:7251389-7251411 TCCCCTCAGAACTTCGGGAAAGG + Intronic
901537396 1:9891442-9891464 TCCCCTCAGAATCCCAGGGCTGG + Intronic
901665345 1:10823051-10823073 TTTCCTCAGAACCCGGGGAGGGG - Intergenic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
904246960 1:29194637-29194659 CTCCCTTAGAACCCCACGACCGG + Intronic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
906154680 1:43606977-43606999 TGCCCTCAGAGCTCCGGGAACGG + Intronic
906715999 1:47969773-47969795 CTCCCTCTGAACCCCAGGGCTGG - Intronic
906797913 1:48712152-48712174 TTGCTTCAGAGCCTCAGGAAAGG - Intronic
907210742 1:52819424-52819446 TTTCCTCATAACTCAAGGAATGG + Intronic
907740916 1:57164800-57164822 GTCTCACAGAACCCAAGGAAGGG - Intronic
907936493 1:59046712-59046734 TTCCCACTGAAGCTCAGGAAGGG - Intergenic
913475132 1:119229792-119229814 TTCCATTAGAACCCCAATAAAGG - Intergenic
915590086 1:156865748-156865770 TGCCCTCAGAAGGCCAGGGAGGG - Intronic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
917723853 1:177811763-177811785 TTTCCTCCAAACCCCAGAAAGGG + Intergenic
919481895 1:198100265-198100287 TTCCCTCAAGACCAAAGGAAAGG + Intergenic
920037746 1:203076637-203076659 TTCCCCCAGAATCCCAAGCATGG - Exonic
922370518 1:224906438-224906460 TTCCCTCAGACCCCAAGGCAAGG + Intronic
922907096 1:229182196-229182218 TACCTTCAGAGGCCCAGGAAGGG - Intergenic
1066682214 10:37945257-37945279 TTCCCACAGAAACCCAATAAAGG + Intergenic
1069526899 10:69180392-69180414 TTGCCCCAGAACCCCGGGAAAGG - Exonic
1070335545 10:75452075-75452097 TTCTTTCAGTACCCAAGGAAGGG + Intronic
1070744879 10:78927642-78927664 CTCCCACACAGCCCCAGGAAGGG + Intergenic
1071028956 10:81149936-81149958 TTCCTTGAGAACCCCAAGACTGG + Intergenic
1071131999 10:82405316-82405338 TTGCCTGAGAACCTCAAGAATGG + Intronic
1072687525 10:97547293-97547315 CTACCTCAGGACTCCAGGAAGGG - Intronic
1073257506 10:102162745-102162767 TTCCCTCAAAACCCTAGAGAGGG + Exonic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1075385056 10:122049493-122049515 TTCCATGAGAACCTCAGGGATGG + Intronic
1075549877 10:123384246-123384268 TTCCCTCATGTCCCCAGGGATGG + Intergenic
1075581256 10:123620209-123620231 CTTCCTCAGAAAGCCAGGAAGGG + Intergenic
1075682717 10:124343942-124343964 TTCCCTCAGCAAATCAGGAAAGG + Intergenic
1077117208 11:890533-890555 TGACCTCAGGAACCCAGGAAGGG - Intronic
1077169142 11:1158668-1158690 GTCCCTCAGAAGCAGAGGAAGGG - Intronic
1078176221 11:8973254-8973276 GTACCACAGAACCCCAGAAAAGG - Intergenic
1078777836 11:14410135-14410157 TTCCCTCCTCACCCCAGAAAGGG - Intergenic
1079312888 11:19381875-19381897 TGTCCTCAGAAACCCAGAAACGG - Intronic
1080749235 11:35137699-35137721 TTCCCTCAGAAGTCCTGGCATGG + Intergenic
1081977610 11:47245644-47245666 TCCCCTCACCACCCCAGGGAAGG + Intronic
1083329934 11:61892726-61892748 TTCCATCAGAACCACCTGAAAGG + Intergenic
1083664016 11:64265088-64265110 CTCCCTCAGCAGCCCAGGTAAGG + Exonic
1083811162 11:65107759-65107781 TAGCCCCAGAGCCCCAGGAAAGG - Intronic
1083856150 11:65394046-65394068 TTCCTTCGGAACTGCAGGAAAGG - Exonic
1084680625 11:70664255-70664277 TTCCCTCTGAACTCCTGAAAGGG + Intronic
1085121416 11:73969862-73969884 TACTCACATAACCCCAGGAAGGG - Intronic
1085784168 11:79437165-79437187 TTCCCTTATAACACCTGGAAAGG + Intronic
1088844339 11:113652188-113652210 TTTCCTCACAACCCCAGGCCAGG + Intergenic
1091108039 11:132941642-132941664 TTCCTTCACATCTCCAGGAAGGG + Intronic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1091430964 12:434306-434328 TGACCCCAGAACCCCAGAAAGGG - Intronic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1091992205 12:4964422-4964444 TGCCCACACAACCCCAAGAAGGG - Intergenic
1092929904 12:13305957-13305979 TTCCTTCAACAGCCCAGGAAAGG - Intergenic
1092974946 12:13735863-13735885 TTCCTTCCGAACCCTGGGAAAGG - Intronic
1094466904 12:30763059-30763081 TTGCTGCAGAACCCCAGTAAGGG - Intergenic
1096088529 12:48882956-48882978 TTTCATTAGATCCCCAGGAAAGG - Intergenic
1096104043 12:48986451-48986473 TACCCTCAGCATCCCAAGAATGG - Intergenic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1097687554 12:62704914-62704936 TACTCTCAGAACTCCAGGCAGGG - Intronic
1101442692 12:104715416-104715438 TTCTCTCAGAGCCACTGGAAGGG + Intronic
1101494198 12:105237823-105237845 TGCCCTCAGAACCCTTGAAAGGG + Intronic
1102238819 12:111310909-111310931 TACCCTGAGTGCCCCAGGAAGGG - Intronic
1102576894 12:113861318-113861340 TTCCCTAAGACCACCAGGCAAGG + Intronic
1104543279 12:129686847-129686869 TTCCCACAGGACCCCATCAATGG + Intronic
1104907574 12:132222247-132222269 TTCCCTAAGAACGACAGCAAAGG + Intronic
1106665363 13:31846327-31846349 TTCTCACGGAAGCCCAGGAAAGG - Intergenic
1111895406 13:94135841-94135863 ATGCCACAGAAACCCAGGAAAGG + Intronic
1113092547 13:106630564-106630586 TTCCTGCAGACCCCAAGGAAAGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113762800 13:112861596-112861618 TTCCTGCAGAATCCCAGGCAGGG - Intronic
1115853371 14:37604503-37604525 TACTCTCAGGAGCCCAGGAAAGG - Intronic
1117675404 14:58151042-58151064 ATCCTTCAGAACCCTAGGGATGG + Intronic
1118390535 14:65291795-65291817 TCCTCCCAGAACCCAAGGAAGGG + Intergenic
1118496429 14:66312205-66312227 TTCTCTCTGAATCCCAGGCATGG + Intergenic
1118943536 14:70361056-70361078 TACCTCCAGAAACCCAGGAACGG + Intronic
1120390269 14:83898146-83898168 TTCCCTCAGGACTCAAGGAATGG + Intergenic
1121338191 14:93089839-93089861 ATCCCTCAGAGCCCCATGCAGGG + Intronic
1121638168 14:95467680-95467702 GTCCCCCAGAATCCCAGGACTGG + Intronic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1123190452 14:106564490-106564512 ATCCCTCAGCTCCCCAGGGAAGG - Intergenic
1124514281 15:30352990-30353012 TCCTCTCAGAACCCCAGGCCAGG + Intergenic
1124728638 15:32177774-32177796 TCCTCTCAGAACCCCAGGCCAGG - Intergenic
1126145342 15:45468399-45468421 TTCCCCCACATCCCCAGGACAGG - Intergenic
1126433448 15:48611086-48611108 ATCCATCAGAAGCCCAGGACAGG + Intronic
1128519268 15:68364793-68364815 TTCTCCCCCAACCCCAGGAAGGG - Exonic
1129122530 15:73409621-73409643 CTCCAACAGAACCACAGGAAAGG + Intergenic
1129607369 15:77031427-77031449 TGCCCCCAGAACCCCAAGACAGG + Intronic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1133018262 16:2954911-2954933 TCTTCTCAGGACCCCAGGAAGGG - Intergenic
1133175334 16:4010192-4010214 CTGCCTCTGAAACCCAGGAAGGG + Intronic
1134798689 16:17065000-17065022 TTCGTTCACAACTCCAGGAAGGG - Intergenic
1135169398 16:20169897-20169919 CTCCCTCAGAACCTCTGGGAGGG - Intergenic
1135238227 16:20778692-20778714 TGCCCTCAAAACCTGAGGAAGGG - Intronic
1135836571 16:25831167-25831189 TTCCCTCACCACCCCATCAAGGG + Intronic
1136425164 16:30165283-30165305 TCCCATTAGAACCCCAGGGAGGG - Intergenic
1137385546 16:48039249-48039271 TTCCTACAGACCCCCAGGAAGGG + Intergenic
1138627980 16:58267418-58267440 ACCTCTCAGAACCGCAGGAAGGG - Intronic
1139848024 16:69934227-69934249 TTCTCTGAGACCTCCAGGAAGGG + Intronic
1140457772 16:75114790-75114812 TGCCCTCAGGGTCCCAGGAAAGG + Intronic
1141897094 16:86965068-86965090 CTCCCCCGGAGCCCCAGGAAGGG - Intergenic
1143373191 17:6453179-6453201 TTCCCTGAGAACCCCAGGCTAGG - Exonic
1143462610 17:7113946-7113968 CTACCCCAGGACCCCAGGAAAGG - Intronic
1144661449 17:17073398-17073420 TTCCCTCAGAACCCGAGCCCTGG - Intronic
1146874143 17:36394580-36394602 TCCCCTGAAAACCACAGGAAAGG - Intronic
1146881496 17:36445491-36445513 TCCCCTGAAAACCACAGGAAAGG - Intergenic
1147065244 17:37918293-37918315 TCCCCTGAAAACCACAGGAAAGG + Intergenic
1148328002 17:46795141-46795163 TTCCCTCAGCACCCGAGGGTGGG - Intronic
1149433977 17:56617911-56617933 CTGCTTCAGAACCCCAAGAAAGG + Intergenic
1149989777 17:61376462-61376484 TTACCCCAGATACCCAGGAAGGG + Intronic
1150128425 17:62653313-62653335 TTCCCAGAGAACCCCAGGGGCGG + Intronic
1150712562 17:67544376-67544398 TTCCCACTGAAGCCCAGGAGGGG + Intronic
1150716829 17:67579316-67579338 TTCCCTCAGGACCCGTTGAAAGG + Intronic
1150858666 17:68777962-68777984 TTCCCTCAGGACAGCAAGAAAGG - Intergenic
1151453922 17:74214985-74215007 TGCCCACTGAACCCCAGGAAGGG - Intronic
1151604279 17:75126408-75126430 TTCCCCCAGAATCCTAGTAACGG + Intronic
1152036723 17:77877974-77877996 TGCCCTCAGAGCCCCAGGCAGGG - Intergenic
1152374542 17:79912426-79912448 TCCACCCAGAACCTCAGGAAAGG - Intergenic
1153910786 18:9704986-9705008 GTCCCTGAGAACCCCAAGGAAGG - Intergenic
1156368388 18:36450370-36450392 TCCCTTTAAAACCCCAGGAATGG - Intronic
1158774855 18:60564929-60564951 TTCCCCCTGAACCACAGGCAAGG - Intergenic
1159209096 18:65292852-65292874 TTCCCTCACAATCACAGAAAAGG + Intergenic
1159467595 18:68804595-68804617 TGCCCTCAGAAGCCAAGAAAGGG + Intronic
1161231448 19:3176927-3176949 TCCCCTCAGACCCCAAGGCAGGG + Intronic
1161311243 19:3595423-3595445 GTCCCTCCCAACCCCAGGAAGGG - Intronic
1161592234 19:5134083-5134105 GTCCCAGAGAACCCCAGGCAGGG + Intronic
1161959728 19:7516683-7516705 TTCCCCCAGGACCCTAGGAAGGG + Intronic
1162060314 19:8090782-8090804 TCCCCTCAAAACCCCAGGGCAGG - Intronic
1164667098 19:30047846-30047868 TTCCTCCAGAAACCCAGGGAAGG - Intergenic
1165318991 19:35074495-35074517 TCCCCTCAGAGCCCCAGGGCAGG - Intergenic
1166257652 19:41618116-41618138 TTCCCTGAGGGCCCCTGGAAGGG - Intronic
1166410290 19:42552246-42552268 TTCCCTGAGGGCCCCTGGAAGGG - Intronic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1168666273 19:58207391-58207413 TTCCATCAGAAGCCCACGAAGGG - Intronic
925866118 2:8227575-8227597 TTCCCTGAGAAAAGCAGGAAAGG - Intergenic
926353559 2:12019564-12019586 TGCCCTGACAACCCCAGAAAGGG - Intergenic
926800418 2:16655294-16655316 TTGCCTCACCAACCCAGGAATGG + Intronic
927954722 2:27200536-27200558 TTTCCTGAGAAGCCGAGGAATGG - Exonic
928111857 2:28516969-28516991 TTCCCTCAAGGCCTCAGGAAGGG - Intronic
928749949 2:34459390-34459412 ACCCTTCAGAACCACAGGAATGG + Intergenic
929855288 2:45632425-45632447 TTCCATCAGAAGACCAGGAAGGG + Intergenic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
931515536 2:63048749-63048771 TTTCCTCGGAACCTAAGGAAGGG + Intergenic
933501918 2:83123951-83123973 TTTCCTCAGAATACCAGAAATGG - Intergenic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
935233197 2:101117128-101117150 AACCCCCAGAACCCCAGGCAAGG + Intronic
937268893 2:120634592-120634614 TTCTCTGAGAGGCCCAGGAATGG - Intergenic
937895315 2:126973333-126973355 TTCCCTCAGCAACCCTGGGAGGG + Intergenic
939428804 2:142075576-142075598 TTCCATCATAACTTCAGGAAGGG + Intronic
940026384 2:149212862-149212884 TTGCCTAAAAACCCCAGGACTGG + Intronic
942890687 2:180982801-180982823 TGCCCTCACAAGCACAGGAAGGG - Intronic
943429613 2:187782869-187782891 CTCCCTCAGAAACACAGAAATGG + Intergenic
943933240 2:193882385-193882407 TTAGGTCAGAACACCAGGAAAGG + Intergenic
945198416 2:207258439-207258461 TTCCTACAGAAGCCCAGAAAGGG + Intergenic
945892173 2:215441806-215441828 CTCCCTCAGAACCAAAGGTATGG + Intergenic
946994809 2:225379310-225379332 TTCCATCAGAAGCCCCAGAATGG + Intergenic
948143267 2:235690139-235690161 ATCCCTCAGTACCTCAGGTAGGG - Intronic
1170440748 20:16376642-16376664 TTCCTTCAGAAGCCAAGTAAAGG - Intronic
1170723885 20:18908423-18908445 TTCCCTTAGAGCCTCAGGTAGGG + Intergenic
1170766252 20:19291961-19291983 TTCCCTCATGACCCCAAGACAGG - Intronic
1172248231 20:33460701-33460723 TTCCCTCAGAATGCCAACAAGGG - Intergenic
1172852087 20:37973777-37973799 CCCCCTCAGAACCCCAAGAGAGG - Intergenic
1173332662 20:42088089-42088111 TCCCCTCTGTACCCCAGCAATGG - Intronic
1174079754 20:47962543-47962565 ATCACTCAGAACCCCTAGAAAGG - Intergenic
1174137942 20:48393370-48393392 ATCACTCAGAACCCCCAGAAAGG + Intergenic
1175487827 20:59357914-59357936 TTCAAGCAGAACCCCAGGAGAGG + Intergenic
1175957498 20:62618811-62618833 TCCCCTCAGAGCCCCGGGGAGGG - Intergenic
1176142476 20:63550912-63550934 CTCCATCTGAACACCAGGAAGGG - Intronic
1176171973 20:63700156-63700178 CTCCCTCAGACCCCCCAGAAAGG + Exonic
1178269462 21:31176591-31176613 TTCCCTCGTAAACCAAGGAACGG + Intronic
1178917936 21:36719422-36719444 TCCCCTCAGATCGCCAGCAAGGG + Intronic
1179725234 21:43338259-43338281 TTCCTGCAGAGCCCCAGGATAGG - Intergenic
1180743576 22:18071312-18071334 TGCCCTGTGAATCCCAGGAAGGG + Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182550812 22:31099966-31099988 TGCCCTGAGAACCCCTGGAGCGG + Intronic
1184290087 22:43493990-43494012 TTCCCTCAGAGCCCCCCAAAAGG - Intronic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
955946927 3:64204325-64204347 TTCCATCAGTCCTCCAGGAAAGG + Intronic
957996369 3:87695226-87695248 CTCCCTCAGAACAGCAGCAATGG + Intergenic
960402667 3:117222180-117222202 TTCCATCAGATCCTCAGAAAAGG - Intergenic
961520531 3:127465065-127465087 TTCCCTGAGACCCCCTGGAAGGG - Intergenic
962251670 3:133839719-133839741 TGCCCTCAGATACCCAGGGAGGG + Intronic
963545882 3:146658148-146658170 TCCCCTCACAACCCCAAGCAGGG - Intergenic
965567824 3:170139592-170139614 TTCCTTCAGAATTCCAGAAAAGG - Intronic
967320178 3:188187300-188187322 TGACCTCAGAACCCCAGAAAAGG - Intronic
968232456 3:197011823-197011845 GCTCCTCAGAACCCCAGCAAAGG - Intronic
968426790 4:529043-529065 TCCACTCAGAAGCCCAGGGATGG + Intronic
968960096 4:3739067-3739089 TTCCCCCATAACCCCAAGCATGG - Intergenic
969146158 4:5125848-5125870 CTCCCACAGACCCCCACGAAGGG + Intronic
979253458 4:118588750-118588772 TCCCCTCAGACCACCAGGGATGG + Intergenic
981716879 4:147760579-147760601 GTCCATCAGAACACCAGGTATGG - Intronic
984422165 4:179537622-179537644 AACACTCAGAAGCCCAGGAAAGG + Intergenic
985892499 5:2726546-2726568 TCCCCTCAGAACCCCCTGGAGGG + Intergenic
986044562 5:4024734-4024756 TTGCATCAGAGACCCAGGAAGGG + Intergenic
986337489 5:6766395-6766417 CAGCCTCAGAACCTCAGGAATGG + Intergenic
986633616 5:9798909-9798931 TTCCCACACAAACCCAGGGAAGG + Intergenic
987038098 5:14037748-14037770 TTCTCTCTAAACCCCAGGCATGG - Intergenic
987533197 5:19148667-19148689 CTTCCTCAGATCCCTAGGAATGG + Intergenic
988454790 5:31377986-31378008 TTCCTTTACAAGCCCAGGAACGG + Intergenic
988882615 5:35519960-35519982 TTCTCTCCGGACCCCAGGCAGGG - Intergenic
990350882 5:54914740-54914762 TTCCTTCATAAACCCATGAAAGG - Intergenic
995191215 5:109320613-109320635 TTCCCTCAAAACCCTGGCAATGG - Intergenic
996117480 5:119634233-119634255 TACCCTCACAACCTCAGAAAGGG - Exonic
996944637 5:129051875-129051897 TTACCACAGAAACCCAGTAAGGG + Intergenic
997663112 5:135604454-135604476 ATCCCTCAGTGCCCCAGGACTGG - Intergenic
998507803 5:142686171-142686193 TTCCCACAGAGCCCTAGGGACGG - Intronic
998712541 5:144843242-144843264 TCCCCTCAGCACCCCTTGAAGGG + Intergenic
999573685 5:152949327-152949349 TTCACTCCGAGCTCCAGGAATGG + Intergenic
999877726 5:155826786-155826808 TGCCTTCTGAACACCAGGAATGG - Intergenic
1000920316 5:167129937-167129959 TTCCCTCAGAACCTCAGCCCTGG - Intergenic
1001253701 5:170167765-170167787 TTCCCCCAGAAGGCCAGGAATGG + Intergenic
1001359877 5:171072259-171072281 TTCCCCTAGAACCTCAAGAAAGG + Intronic
1002319462 5:178366291-178366313 TTCCCTCTGCACCCCACGATGGG + Intronic
1003316360 6:5015773-5015795 TGCCCTCAAAACCCATGGAATGG - Intergenic
1003535870 6:6975017-6975039 AGCCCTCAGAACCCTAGGAGAGG + Intergenic
1004149684 6:13104268-13104290 TTCCTTCAGCACCATAGGAAAGG + Intronic
1006254613 6:32820483-32820505 TTCCCTCAGAGCTGAAGGAAGGG + Intronic
1006565957 6:34957484-34957506 TTATCTCTGAACCTCAGGAAAGG - Intronic
1007044221 6:38756135-38756157 TTCCTTCTGAGCCCTAGGAAGGG + Intronic
1013424619 6:109999453-109999475 ATCCCTGAGATCCCGAGGAATGG - Intergenic
1013441998 6:110179937-110179959 ATACCACAGAACCTCAGGAAAGG - Exonic
1013550601 6:111204041-111204063 TTCCCTGAGAACACCAGGTTAGG - Intronic
1013980968 6:116128706-116128728 TTCCCTCAGGACAGCAGGAGTGG - Intronic
1015232291 6:130929192-130929214 TGCTATCAGAACACCAGGAATGG + Intronic
1016758035 6:147708323-147708345 TTCCCTCACAACCCTCAGAAGGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018145557 6:160884085-160884107 TTGCCTGAGAATGCCAGGAAAGG - Intergenic
1018369748 6:163156727-163156749 TTCCAGCAGAGCCCCAGGAGGGG - Intronic
1019102067 6:169639778-169639800 TTGCCTCATAACCCCTAGAACGG + Intronic
1019298116 7:289806-289828 TGCCCTGAGCGCCCCAGGAAGGG + Intergenic
1019479116 7:1258095-1258117 TTCCCTGAGAACCCCAGATTAGG - Intergenic
1019481857 7:1270578-1270600 TGCCCTCAGCACCCCTGGGAAGG + Intergenic
1019593158 7:1845867-1845889 ATCCCTCCAAGCCCCAGGAAAGG + Intronic
1020180689 7:5920193-5920215 TTCCCTCAGCTCCCCCCGAATGG + Intronic
1020302241 7:6804689-6804711 TTCCCTCAGCTCCCCCCGAATGG - Intronic
1022193189 7:28037041-28037063 TTCCCTCTGCACCCCAGTAAGGG - Intronic
1022639179 7:32165318-32165340 TCCTCTCCAAACCCCAGGAAGGG + Intronic
1023341608 7:39227498-39227520 TTACATCAGAACTCCATGAAGGG - Intronic
1023842882 7:44106813-44106835 CTCCCTCAGAAACCCTGGAGTGG + Exonic
1023864786 7:44233511-44233533 TCCCCTGAGAACCCCAGGCCAGG - Intronic
1024629900 7:51238375-51238397 TTCACACAGAAGCCCAGGGAAGG - Intronic
1026481724 7:70785285-70785307 TTCCCTGAGATACCAAGGAATGG - Intronic
1028486096 7:91359232-91359254 TTCACTCAGATCTCTAGGAAGGG + Intergenic
1031963977 7:128014023-128014045 TCTCCTCAGAGCCCCAGGCAAGG - Intronic
1033599229 7:142876957-142876979 TTCCTGCAGAACCAGAGGAAGGG + Intronic
1034888896 7:154822082-154822104 TGCCCTCAGAGCCCCAGGGAAGG - Intronic
1035046295 7:155969526-155969548 TTCTCTCTGCACCCCTGGAATGG + Intergenic
1035114798 7:156515740-156515762 TTCCCCCAGACCCCTAGGGAAGG + Intergenic
1037135526 8:15455225-15455247 CTCCCCCAAAACCCCAGGACTGG + Intronic
1039646162 8:39285292-39285314 CTCCCTCAGAAACCCAGGCTGGG - Intergenic
1040744195 8:50620080-50620102 CTCCCTTAGATCCCCTGGAAAGG - Intronic
1047083869 8:121494711-121494733 TTCCCTAAGGACCCAAGAAATGG - Intergenic
1049751928 8:144288981-144289003 GTCCCTCAGAACCCCAAGGCCGG - Intronic
1049999655 9:1063595-1063617 TTGGCTCAGAACTCCAGGCATGG - Intergenic
1050113846 9:2242724-2242746 TGCCCTCAGCACCTCAGGGAGGG - Intergenic
1050723261 9:8615482-8615504 TTTCCTCAAAACACCATGAAAGG - Intronic
1051062633 9:13062466-13062488 TTCCCTGAGAACACTAGCAATGG + Intergenic
1053268632 9:36734653-36734675 TTCCCCCAGAACCATAGGAGAGG - Intergenic
1056809719 9:89754782-89754804 TTCCCTGACAGTCCCAGGAACGG - Intergenic
1057184389 9:93048752-93048774 TTCCTTCAAAACCACAGTAAAGG - Intergenic
1058577189 9:106416239-106416261 TTCCTCCAGAACCCCAGAAAGGG + Intergenic
1059187941 9:112293766-112293788 TTCCATCATACCCACAGGAAGGG - Intronic
1060998104 9:127886264-127886286 TTGGTTCAGAGCCCCAGGAATGG - Exonic
1061041814 9:128144956-128144978 AGCCCCCAGCACCCCAGGAAAGG - Intergenic
1061160034 9:128888431-128888453 TTCCTTCCTATCCCCAGGAAGGG - Intronic
1061466709 9:130786147-130786169 TTCCCACAGAAGCCCAACAAAGG - Intronic
1061944988 9:133903563-133903585 TGTCCTGAGAACCCCAGAAAAGG - Intronic
1062268677 9:135699151-135699173 GGCCCTGAGAACCCCAGAAAAGG + Intronic
1062395766 9:136351978-136352000 TTCCCTGAGGACCCCAGCAGAGG - Intronic
1191846646 X:65551910-65551932 TTCCTTCGGAACTGCAGGAAAGG + Intergenic
1197278989 X:124513176-124513198 TTCCCTTAGAGCCTCTGGAAAGG - Intronic
1198263768 X:134990850-134990872 AGGCCCCAGAACCCCAGGAAGGG - Intergenic
1198413382 X:136394352-136394374 TTCCCTAAGAACGCCAGGAGTGG + Intronic
1200257767 X:154593825-154593847 GTCTCTCAGAAGCCCAGGACAGG - Intergenic