ID: 954615091

View in Genome Browser
Species Human (GRCh38)
Location 3:51965455-51965477
Sequence CTGAGTGATCACATCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954615091_954615098 29 Left 954615091 3:51965455-51965477 CCAAGTCAGATGTGATCACTCAG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 954615098 3:51965507-51965529 AACTCAAAGAAGTCCCCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 83
954615091_954615097 28 Left 954615091 3:51965455-51965477 CCAAGTCAGATGTGATCACTCAG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 954615097 3:51965506-51965528 CAACTCAAAGAAGTCCCCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954615091 Original CRISPR CTGAGTGATCACATCTGACT TGG (reversed) Intronic
900632738 1:3645575-3645597 CTGAGTGCTCATAGCTGTCTGGG - Intronic
901418496 1:9134316-9134338 TTGAATGATCACAAGTGACTTGG - Intergenic
902817906 1:18926579-18926601 CGGAGAGACCACATCTGGCTGGG - Intronic
906100064 1:43254490-43254512 CTGAGAGATCACACTGGACTTGG + Intronic
907167952 1:52431386-52431408 CTGAGTAATAGCAGCTGACTGGG + Exonic
907178697 1:52551771-52551793 CTGAATTATCATATCTGGCTGGG + Intronic
908001512 1:59684781-59684803 CTGTGTGAACACACCTGGCTGGG + Intronic
909483692 1:76151648-76151670 CTGAGTGATCACACCTGAGAGGG + Intronic
910903742 1:92150962-92150984 CTGAAGGATAACATCAGACTGGG + Intergenic
912257958 1:108080331-108080353 CTGAGAAATCACCACTGACTTGG - Intergenic
912535558 1:110366894-110366916 CTCAATGATCAAATATGACTGGG - Intronic
915100542 1:153495826-153495848 CCTAGTGTTCACATCTGCCTTGG - Intergenic
919346897 1:196393431-196393453 CTGAGTAACCTCATCTGACTAGG + Intronic
920938936 1:210462644-210462666 CTGTTTGATCACTTCTGAATGGG + Intronic
922889922 1:229053995-229054017 CTAAGGGATCACCACTGACTTGG - Intergenic
924102241 1:240616847-240616869 ATGAGTCACCACATCTGGCTTGG - Intergenic
1063037291 10:2298924-2298946 CTTAGTGTTCACGTCAGACTTGG + Intergenic
1066610254 10:37238161-37238183 CTGAGCATTCACATCTGACCTGG + Intronic
1071121964 10:82288525-82288547 CTGAGTGAACACATCCCACACGG - Intronic
1072550417 10:96473054-96473076 CTCAGTGTTCCCATCTGATTGGG - Intronic
1073708508 10:106014266-106014288 CTCAGTCATCCCATCTGCCTAGG + Intergenic
1084005222 11:66319030-66319052 AGAAGTGATCAGATCTGACTTGG - Intergenic
1087225305 11:95592354-95592376 GTGAGAGATCACTTTTGACTGGG - Intergenic
1089773651 11:120820961-120820983 CTGGGTGGTCACAGCTGAGTTGG - Intronic
1090255938 11:125284347-125284369 CTGAGAGGTCACCTCTGCCTTGG - Intronic
1092288118 12:7141592-7141614 ATGGGTCATCACCTCTGACTTGG + Intronic
1093977383 12:25438139-25438161 CTGAGTCATCTCATTTTACTTGG + Intronic
1095369033 12:41443917-41443939 CTTACTTATCACATCTGCCTGGG - Intronic
1098739075 12:74147806-74147828 CTGAGTGGTAACATTTGTCTTGG - Intergenic
1098949631 12:76626383-76626405 CAAAGTGATAACAGCTGACTTGG + Intergenic
1101789651 12:107915040-107915062 CTGAGTGGTGACATCTGCCCTGG + Intergenic
1104506557 12:129337693-129337715 CGGAGAGATCACGTCTGACTTGG - Exonic
1105285281 13:18998378-18998400 CTGAGCATTCACATCTGATTTGG + Intergenic
1106439282 13:29751147-29751169 ATGAGTGAGCACAGCTGACTAGG + Intergenic
1106937100 13:34735037-34735059 GTGAATGATCAAACCTGACTGGG + Intergenic
1109401519 13:61835802-61835824 CTGAGTGACCCCATCAGAGTGGG + Intergenic
1110397115 13:75043603-75043625 CTGAGTCATTACATGTGACCTGG - Intergenic
1112854871 13:103756190-103756212 GTGAGTGATCACTTTTTACTGGG - Intergenic
1113521051 13:110941270-110941292 CTCAGTGTTCACATCTGTATTGG + Intergenic
1114520150 14:23328865-23328887 AGGAGTGATTACTTCTGACTTGG - Intergenic
1121830859 14:97050905-97050927 CTGAGGGAACAGAGCTGACTTGG + Intergenic
1122851745 14:104537092-104537114 CTGAGTGAGCATCTCTGACATGG - Intronic
1127286638 15:57539000-57539022 CAGGGTGATAACATCTGCCTCGG + Intronic
1132591758 16:729165-729187 CTGAGTGAGCATCTCTGGCTTGG + Intronic
1139204201 16:65010337-65010359 CTGAGTGATGAGATCTGAACGGG - Intronic
1140700380 16:77575886-77575908 CTGAGTGATCAAATGACACTGGG - Intergenic
1145871289 17:28275605-28275627 CTGAGTGCTGACCTCTGACATGG - Intergenic
1150699054 17:67431777-67431799 CAGAGTGATCATATCTTCCTTGG - Intronic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1155407170 18:25501813-25501835 TTGAGTCCTCACACCTGACTGGG - Intergenic
1158551327 18:58438542-58438564 CTGACTGCTCACATCAGACAAGG - Intergenic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1162423050 19:10577073-10577095 ATGAGCCATCACACCTGACTGGG + Intronic
1163415936 19:17186511-17186533 CTGTGTGCTCACATTTGTCTGGG - Intronic
1164445000 19:28309364-28309386 CTGTGTGCTCACATCAGCCTGGG + Intergenic
1165299620 19:34960598-34960620 CTGTGTGACTACCTCTGACTCGG - Intronic
1166619442 19:44283099-44283121 CTGACTAATAACATGTGACTAGG + Intronic
1168233555 19:55047972-55047994 CACAGTGATCACAGCTGGCTTGG - Intronic
1168671867 19:58246723-58246745 CTGAGAGATCACATCAGATTTGG - Exonic
930027305 2:47036953-47036975 CTGGGTGATCACACTTGAATGGG + Intronic
930266522 2:49206439-49206461 ATGAGTGATCACTTTTTACTGGG - Intergenic
934510728 2:94939758-94939780 CTGACTGACCACAGTTGACTGGG - Intergenic
935826268 2:106953477-106953499 ATGAATCATCACATCTGCCTAGG - Intergenic
935977548 2:108593776-108593798 CTAAGAAATCACATCTGACTTGG - Intronic
936959394 2:118057469-118057491 CTGGCTGACCACATCTGACCGGG + Intergenic
937035359 2:118777133-118777155 CTGAGAGATCACCTCTTAATAGG + Intergenic
937290599 2:120779476-120779498 CAGAGTGCACACACCTGACTTGG + Intronic
940629481 2:156219778-156219800 ATGAGTGTTCACCTCTGGCTAGG - Intergenic
944845951 2:203667948-203667970 CTGTGTTATCACATCTGCTTTGG + Intergenic
1168890756 20:1294235-1294257 CTGAGTGCTCTCGTCTGCCTTGG - Intronic
1171116214 20:22526843-22526865 CTGGGTGTTCACATCCGACATGG - Intergenic
1180089154 21:45524893-45524915 CTGAGTGTTCACACCTGGGTCGG + Intronic
950039001 3:9907698-9907720 CAAAATGATCACATCTGTCTTGG + Intronic
950310283 3:11951991-11952013 CTGACTGACCACAGCTCACTTGG - Intergenic
953216460 3:40923251-40923273 CTGTGTCAACACAACTGACTAGG - Intergenic
954615091 3:51965455-51965477 CTGAGTGATCACATCTGACTTGG - Intronic
958647464 3:96890801-96890823 ATGAGCCACCACATCTGACTGGG - Intronic
960635649 3:119781995-119782017 CTTAGTGCCTACATCTGACTTGG + Intronic
969134098 4:5016177-5016199 CTGAGTGATGACCTCTGCCATGG + Intronic
969328982 4:6462003-6462025 CTGGGTGACCACATCTGAGCTGG - Intronic
969565914 4:7977995-7978017 CTGAGTTATCAGCTGTGACTGGG + Intronic
973783525 4:54313897-54313919 GTGAGTCATCGCATCTGGCTTGG - Intergenic
975863491 4:78702528-78702550 GGGAGGGATCACCTCTGACTGGG + Intergenic
975947239 4:79722144-79722166 CTGAGTGATAAGATATGACTTGG - Intergenic
976484149 4:85580801-85580823 CACAGTGATCGTATCTGACTGGG + Intronic
977513177 4:97987936-97987958 CGGAGTGATACAATCTGACTCGG - Intronic
979167502 4:117554523-117554545 CTGAGTGATTAATTTTGACTAGG + Intergenic
979353880 4:119679357-119679379 ATGACTGATTACATCTGAGTGGG + Intergenic
980653793 4:135756004-135756026 CAGAGTGATCACATATCACTTGG + Intergenic
980718654 4:136662480-136662502 CTGCCTGCTCAAATCTGACTTGG - Intergenic
981470608 4:145130331-145130353 CTGAGTGCTCACAGCAGACTAGG - Intronic
983664009 4:170162340-170162362 CTGAGTCTTCACATCTCACCTGG + Intergenic
988669228 5:33362929-33362951 CTGAGTCCTCACGTCAGACTTGG - Intergenic
990176456 5:53113925-53113947 CTGAGTAAACACCTCTGACGTGG - Intergenic
990606408 5:57414916-57414938 ATGAGTGAACACTTCTGATTTGG + Intergenic
992993678 5:82311578-82311600 CTGAGTTATCTCACCTGACGGGG - Intronic
995701174 5:114937704-114937726 CTGAGAAATAACATCTGACAAGG + Intergenic
998277258 5:140768503-140768525 TTCAGTGATCACATTTGACAAGG - Intergenic
998486765 5:142509735-142509757 CTGAGTGAACACCACTGACAAGG + Intergenic
998859510 5:146428713-146428735 CTGGGTGATTACACCTGACAGGG + Intergenic
1000089984 5:157921866-157921888 CTGAGTGATGGCATCCCACTTGG + Intergenic
1002055459 5:176595882-176595904 CTGAGTGGTCACAAGGGACTTGG + Exonic
1002132302 5:177089051-177089073 CTGGGTGGTCACAACTGACAAGG - Intronic
1006389256 6:33748908-33748930 CTGACTGATCACATTTCACCAGG + Intergenic
1008613226 6:53203132-53203154 CTCAGTGGTCACATATGACCAGG - Intergenic
1011945563 6:92897920-92897942 CAAAGTGTTCACATCTGAGTTGG + Intergenic
1013064267 6:106668695-106668717 CTCTGTGATGACATCAGACTGGG + Intergenic
1013252419 6:108347583-108347605 CTGAGTGGTCACTTCTTTCTAGG + Intronic
1013291451 6:108722388-108722410 CTTACTGCTCACATATGACTAGG + Intergenic
1013318323 6:108962370-108962392 TTGAGTAATCACTTCTGTCTGGG + Intronic
1014280728 6:119440791-119440813 CAGAGGAATCACATCTTACTTGG + Intergenic
1014552590 6:122806113-122806135 ATTAGTGATCACATATCACTTGG + Intronic
1021761462 7:23906115-23906137 CTGCGTGATCAAATCTGGTTGGG + Intergenic
1024421694 7:49174918-49174940 CTCATTGATCACATCTCTCTGGG + Intergenic
1024920765 7:54551850-54551872 CAGATTGATGACATCTAACTTGG - Intronic
1025747169 7:64253276-64253298 CTAAGTGAACATCTCTGACTTGG + Intronic
1028204760 7:88003887-88003909 CTGAGTGCTCACTTGAGACTCGG - Intronic
1030092584 7:105870842-105870864 CTGACTGATCCAAGCTGACTGGG + Intronic
1030298661 7:107953885-107953907 CAGGGTGATCACATCTGAAGGGG + Intronic
1030300939 7:107974057-107974079 ATGAGTCATCACACCTGACCAGG + Intronic
1034726851 7:153344281-153344303 CTGTATGATCGCATTTGACTAGG + Intergenic
1034823113 7:154235205-154235227 CAGAGTGATCACAGATGCCTGGG - Intronic
1036956615 8:13194546-13194568 CTGAGTCAACACACCTGATTTGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1043661028 8:82741247-82741269 CTGATTGGTCACATCAGAATAGG + Intergenic
1043846932 8:85174287-85174309 CTGAGTGCTCACGCCTGGCTGGG - Intergenic
1044247114 8:89961470-89961492 CAGAATAATTACATCTGACTTGG + Intronic
1050456105 9:5836018-5836040 TTGAGTCAACTCATCTGACTTGG + Intergenic
1052769917 9:32678143-32678165 CTGAATGAAAACACCTGACTTGG + Intergenic
1057534066 9:95881258-95881280 CTGGGTGATGACATGGGACTTGG + Exonic
1057747399 9:97762978-97763000 CTGAGTGATCTCATCCAGCTTGG - Intergenic
1061619225 9:131800355-131800377 CTGAGAGCTCACAACTGAGTGGG - Intergenic
1061873247 9:133531681-133531703 CAGAGTTCTCACACCTGACTGGG - Intergenic
1188052700 X:25507286-25507308 CTCCGTGATCACATCTGATGAGG + Intergenic
1188242792 X:27810029-27810051 CTGAGTGGTCTGATCTGACAGGG - Intronic
1190536984 X:51438954-51438976 GTGTGTGTTCACATCTGTCTGGG + Intergenic
1190968251 X:55323365-55323387 CTGTGGGATCACACCTGGCTTGG + Intergenic
1192373997 X:70540672-70540694 CTGAGTGAACAACCCTGACTGGG + Intronic
1193751617 X:85352578-85352600 ATAAGTGACCAAATCTGACTAGG + Intronic
1195080127 X:101362706-101362728 GAGAGAGATCACATCTGACATGG + Intronic
1196656027 X:118217830-118217852 CTGGGTGATCAAAGTTGACTGGG + Intergenic
1197951718 X:131904725-131904747 CTGAGTGATGACCTTTGACGAGG - Intergenic
1198111331 X:133505010-133505032 CTGAGTGACCACCTCTGTCCAGG + Intergenic
1202016650 Y:20413969-20413991 CTGTGTGAACACATCTGGATGGG + Intergenic