ID: 954615825

View in Genome Browser
Species Human (GRCh38)
Location 3:51968164-51968186
Sequence GGCTCCGTTGAGTCTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954615821_954615825 5 Left 954615821 3:51968136-51968158 CCTTTTGGGGATAGGGTCGCAAG 0: 1
1: 0
2: 2
3: 4
4: 57
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615809_954615825 27 Left 954615809 3:51968114-51968136 CCCCAAATCTACCCCCGGAATTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615810_954615825 26 Left 954615810 3:51968115-51968137 CCCAAATCTACCCCCGGAATTCC 0: 1
1: 0
2: 1
3: 5
4: 84
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615816_954615825 15 Left 954615816 3:51968126-51968148 CCCCGGAATTCCTTTTGGGGATA 0: 1
1: 0
2: 0
3: 4
4: 88
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615815_954615825 16 Left 954615815 3:51968125-51968147 CCCCCGGAATTCCTTTTGGGGAT 0: 1
1: 0
2: 0
3: 8
4: 71
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615811_954615825 25 Left 954615811 3:51968116-51968138 CCAAATCTACCCCCGGAATTCCT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615817_954615825 14 Left 954615817 3:51968127-51968149 CCCGGAATTCCTTTTGGGGATAG 0: 1
1: 0
2: 1
3: 14
4: 139
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
954615818_954615825 13 Left 954615818 3:51968128-51968150 CCGGAATTCCTTTTGGGGATAGG 0: 1
1: 0
2: 2
3: 16
4: 143
Right 954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954615825 Original CRISPR GGCTCCGTTGAGTCTTTTAC TGG Intronic
904006339 1:27365185-27365207 GGACCAGTTGAGTCTGTTACGGG + Intronic
923108313 1:230870833-230870855 AGCTCCCTTGAGTCTCTTACAGG - Intergenic
1066953792 10:42146991-42147013 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
1074099822 10:110346009-110346031 GGCTCTTTTGACTCTTTTTCTGG + Intergenic
1076323542 10:129601986-129602008 GGCTCTGCTGAGCCTTTGACTGG + Intronic
1089687197 11:120160807-120160829 GTGTCCCTTGAGTCTTTGACAGG - Intronic
1104617770 12:130284802-130284824 TGCTCCTTTGAGTCTTCTCCAGG - Intergenic
1106110828 13:26775313-26775335 GGCTCCGTATTGTCTTTTAGTGG + Intergenic
1106866844 13:33973925-33973947 GGTGCCTTTGAGTCTTCTACTGG - Intergenic
1107072954 13:36291923-36291945 TTCTCCTTTGAGTCTTTTATAGG - Intronic
1107535865 13:41330848-41330870 TGCTCCTTTGAGGCTTTTATGGG + Intronic
1115532569 14:34340849-34340871 CTCTCCTTTGAGTCTTTTGCAGG - Intronic
1122383983 14:101331437-101331459 GGCCCCCTTGAGTCCTCTACAGG - Intergenic
1123025230 14:105420816-105420838 GACTCCGTGGGGTCTTTCACAGG + Intronic
1123982349 15:25615383-25615405 GGCTGCATTGAGTCTTTTTCTGG - Intergenic
1136771266 16:32843660-32843682 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
1136868294 16:33773564-33773586 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1136899309 16:34017793-34017815 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1137083872 16:36098830-36098852 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
1138415487 16:56869134-56869156 GGAACCGTTGTGGCTTTTACAGG + Intronic
1203073689 16_KI270728v1_random:1105770-1105792 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
1203103880 16_KI270728v1_random:1342712-1342734 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
1203129634 16_KI270728v1_random:1619656-1619678 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1145690558 17:26734272-26734294 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1145710335 17:26965436-26965458 GGCTGCATTGAGTCTTTTTTAGG - Intergenic
1146385272 17:32365667-32365689 GGCTCCGTTCAACCTTTTATGGG - Intronic
1146535149 17:33643723-33643745 AGCTCTGTTCAGTGTTTTACAGG - Intronic
1148517341 17:48232512-48232534 GGTTCCATTGTGTATTTTACAGG + Intronic
1155417584 18:25616393-25616415 GGCTCCGTTCACTCATTTATTGG + Intergenic
1160497009 18:79381666-79381688 GGCCACGTTGTGTCTTTTCCAGG - Intergenic
1167000139 19:46741004-46741026 GGCTTCACTGAGCCTTTTACAGG - Intronic
1202670207 1_KI270709v1_random:42939-42961 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
926780028 2:16462032-16462054 GGCTCTTTAGAGTCTTTTTCTGG + Intergenic
927336806 2:21934353-21934375 GGCTGCATTCAGTCTTTTTCTGG - Intergenic
934044378 2:88160306-88160328 GGCTTCATTGAGTCTCTCACAGG + Intergenic
934251211 2:90357478-90357500 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
934258350 2:91445923-91445945 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
938103034 2:128511401-128511423 GGCTCCCCTGAGTCTTTCATGGG - Intergenic
948810129 2:240470621-240470643 GTCTCCTATGAGTTTTTTACTGG - Intergenic
1172510664 20:35498692-35498714 GGGTCTGTTGAGTCTTCCACAGG - Exonic
1203324643 22_KI270738v1_random:2363-2385 GGCTGCATTGAGTCTTTTTAAGG + Intergenic
951308925 3:21099982-21100004 GTCTTCGTTGAGTCTTATAGTGG - Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG + Intronic
963106666 3:141653369-141653391 TTCTCCATTGAGTTTTTTACTGG + Intergenic
964044727 3:152309214-152309236 GGCTATGTGAAGTCTTTTACTGG - Intronic
965023562 3:163267483-163267505 GGCTGTGATGAGTCTGTTACTGG - Intergenic
965437798 3:168673892-168673914 GGTTCCCTTAAGTCTTTCACTGG - Intergenic
965868432 3:173235587-173235609 GGCTCAGCTGAGACTTTTGCTGG - Intergenic
966528473 3:180945803-180945825 GTCTCAGTTGAGTCATTAACTGG + Intronic
967817569 3:193812382-193812404 GGCTCAGTTGACTTTGTTACAGG - Intergenic
968222826 3:196951042-196951064 GACTCCTTTGACTCTTTTTCTGG + Intronic
968386570 4:144480-144502 GGCTATTTTGAGTCTTTTATGGG + Intronic
982424579 4:155243270-155243292 AGCTCCCTTGTGTCTTTTATAGG + Intergenic
997469781 5:134110753-134110775 GGCTCCTTTGAGACGTTTTCTGG + Intergenic
1003539332 6:7004486-7004508 GGCTGCTTTGAGTCTTGTTCTGG - Intergenic
1009759606 6:67987156-67987178 GCCTCCCTTGACTCTTTAACTGG + Intergenic
1013633641 6:112008684-112008706 GGCTCCGTTATGCCTATTACAGG + Intergenic
1018526904 6:164722551-164722573 GGCTTCCTTGGGTCTTTTCCAGG + Intergenic
1025320732 7:58090592-58090614 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1025479036 7:60959579-60959601 GGCTGCATTGAGTCTTTTTAAGG - Intergenic
1029332075 7:99866560-99866582 GGTTCTGTGGGGTCTTTTACAGG + Intergenic
1031219320 7:118945186-118945208 GGATCCCTGGTGTCTTTTACTGG + Intergenic
1046456744 8:114475147-114475169 GGCTCCGAAGAGCCTTTTATTGG - Intergenic
1048808744 8:138265459-138265481 GTCTCCATTGACTCATTTACTGG - Intronic
1052487171 9:29117260-29117282 GGCTCAGTTCAGTTGTTTACTGG + Intergenic
1199339771 X:146663053-146663075 GGCTCTGTTCATTCTTTTACAGG - Intergenic