ID: 954622140

View in Genome Browser
Species Human (GRCh38)
Location 3:52002379-52002401
Sequence CTGTCACAAGGCCCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954622140_954622144 16 Left 954622140 3:52002379-52002401 CCATGGAGGGGGCCTTGTGACAG No data
Right 954622144 3:52002418-52002440 AGAGAAGCCCGTGGCCTTTATGG No data
954622140_954622146 23 Left 954622140 3:52002379-52002401 CCATGGAGGGGGCCTTGTGACAG No data
Right 954622146 3:52002425-52002447 CCCGTGGCCTTTATGGCCAACGG No data
954622140_954622143 7 Left 954622140 3:52002379-52002401 CCATGGAGGGGGCCTTGTGACAG No data
Right 954622143 3:52002409-52002431 CATGTGACGAGAGAAGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954622140 Original CRISPR CTGTCACAAGGCCCCCTCCA TGG (reversed) Intergenic
No off target data available for this crispr