ID: 954624349

View in Genome Browser
Species Human (GRCh38)
Location 3:52014488-52014510
Sequence GGCTGTTGGTAGAAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954624341_954624349 26 Left 954624341 3:52014439-52014461 CCAGGTTGGGTGCACACGTGTGC No data
Right 954624349 3:52014488-52014510 GGCTGTTGGTAGAAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954624349 Original CRISPR GGCTGTTGGTAGAAGCCTGG AGG Intergenic
No off target data available for this crispr