ID: 954624674

View in Genome Browser
Species Human (GRCh38)
Location 3:52016040-52016062
Sequence CAGCAGCCGCTCAGTAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954624669_954624674 -2 Left 954624669 3:52016019-52016041 CCAGGTCACTCCCAGCCTGTTCA No data
Right 954624674 3:52016040-52016062 CAGCAGCCGCTCAGTAATTAGGG No data
954624668_954624674 4 Left 954624668 3:52016013-52016035 CCAAATCCAGGTCACTCCCAGCC No data
Right 954624674 3:52016040-52016062 CAGCAGCCGCTCAGTAATTAGGG No data
954624667_954624674 11 Left 954624667 3:52016006-52016028 CCTCGGTCCAAATCCAGGTCACT No data
Right 954624674 3:52016040-52016062 CAGCAGCCGCTCAGTAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954624674 Original CRISPR CAGCAGCCGCTCAGTAATTA GGG Intergenic
No off target data available for this crispr