ID: 954628415

View in Genome Browser
Species Human (GRCh38)
Location 3:52035410-52035432
Sequence ATGTTCCCACAGAGGGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954628415_954628425 18 Left 954628415 3:52035410-52035432 CCTCGCTCCCTCTGTGGGAACAT No data
Right 954628425 3:52035451-52035473 CCTACCCTCGTGGAGTCTCATGG No data
954628415_954628421 8 Left 954628415 3:52035410-52035432 CCTCGCTCCCTCTGTGGGAACAT No data
Right 954628421 3:52035441-52035463 GTGAGCCAGCCCTACCCTCGTGG No data
954628415_954628426 19 Left 954628415 3:52035410-52035432 CCTCGCTCCCTCTGTGGGAACAT No data
Right 954628426 3:52035452-52035474 CTACCCTCGTGGAGTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954628415 Original CRISPR ATGTTCCCACAGAGGGAGCG AGG (reversed) Intergenic
No off target data available for this crispr