ID: 954628608

View in Genome Browser
Species Human (GRCh38)
Location 3:52036226-52036248
Sequence GCCCTGGGGATGCACCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954628608_954628614 -7 Left 954628608 3:52036226-52036248 CCCTGACGGTGCATCCCCAGGGC No data
Right 954628614 3:52036242-52036264 CCAGGGCTCTTCCCCCAGCAGGG No data
954628608_954628612 -8 Left 954628608 3:52036226-52036248 CCCTGACGGTGCATCCCCAGGGC No data
Right 954628612 3:52036241-52036263 CCCAGGGCTCTTCCCCCAGCAGG No data
954628608_954628615 -2 Left 954628608 3:52036226-52036248 CCCTGACGGTGCATCCCCAGGGC No data
Right 954628615 3:52036247-52036269 GCTCTTCCCCCAGCAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954628608 Original CRISPR GCCCTGGGGATGCACCGTCA GGG (reversed) Intergenic
No off target data available for this crispr