ID: 954631813

View in Genome Browser
Species Human (GRCh38)
Location 3:52051868-52051890
Sequence GTGATGGGGCTTCATAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954631807_954631813 18 Left 954631807 3:52051827-52051849 CCTAAGACACATGGACTGGGATG 0: 1
1: 0
2: 1
3: 21
4: 174
Right 954631813 3:52051868-52051890 GTGATGGGGCTTCATAAGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 87
954631804_954631813 24 Left 954631804 3:52051821-52051843 CCAGCTCCTAAGACACATGGACT 0: 1
1: 0
2: 1
3: 15
4: 107
Right 954631813 3:52051868-52051890 GTGATGGGGCTTCATAAGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 87
954631811_954631813 -9 Left 954631811 3:52051854-52051876 CCACACTATCACTTGTGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 88
Right 954631813 3:52051868-52051890 GTGATGGGGCTTCATAAGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954631813 Original CRISPR GTGATGGGGCTTCATAAGTG AGG Intronic