ID: 954633155

View in Genome Browser
Species Human (GRCh38)
Location 3:52057586-52057608
Sequence TTTGTTCTAGCGCTACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633155_954633158 -8 Left 954633155 3:52057586-52057608 CCCGCAGGTAGCGCTAGAACAAA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 954633158 3:52057601-52057623 AGAACAAAGCGGCTAGACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
954633155_954633160 9 Left 954633155 3:52057586-52057608 CCCGCAGGTAGCGCTAGAACAAA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 43
954633155_954633159 -5 Left 954633155 3:52057586-52057608 CCCGCAGGTAGCGCTAGAACAAA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 954633159 3:52057604-52057626 ACAAAGCGGCTAGACGCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633155 Original CRISPR TTTGTTCTAGCGCTACCTGC GGG (reversed) Intergenic
903011196 1:20331627-20331649 TTTGCTCCAGAGCTCCCTGCTGG - Intronic
906222169 1:44089380-44089402 TTTGCTCCAGAGCTCCCTGCTGG - Intergenic
907769933 1:57451352-57451374 TTTGTTCTATCACATCCTGCTGG + Intronic
913119959 1:115730923-115730945 TCTGTCCTAGCACTCCCTGCTGG + Intronic
915137553 1:153743878-153743900 TTCTTTCTAGAGCTGCCTGCTGG - Intronic
917022660 1:170607018-170607040 TTTTTTTTATAGCTACCTGCTGG + Intergenic
921369037 1:214402893-214402915 TGTGTTCTTGGGCTACCTTCTGG + Exonic
1075567059 10:123512488-123512510 AATGTTCTAGCGCAACCAGCAGG - Intergenic
1077521386 11:3037456-3037478 TTTGTGCCAGCGCCGCCTGCTGG - Intronic
1077965709 11:7130714-7130736 TTTGTTCTAAGTCTACCTGATGG - Intergenic
1084307485 11:68296587-68296609 TTGGTTACAGAGCTACCTGCTGG + Intergenic
1086176992 11:83902662-83902684 TTAGTTTTAGTGCTACCTTCTGG - Intronic
1092955265 12:13543667-13543689 TTTGTTCTCACTCTTCCTGCCGG + Exonic
1098384803 12:69907481-69907503 TTTGTTCCTGCCCCACCTGCAGG - Intronic
1102209492 12:111114892-111114914 TTTGTTCTAGCACCATTTGCTGG + Intronic
1105557062 13:21457592-21457614 TTTATTCTGGGCCTACCTGCAGG + Intronic
1107835623 13:44410499-44410521 TCTGTCCTAGCGCACCCTGCAGG + Intergenic
1129028330 15:72600051-72600073 TTTGTTCTGATGCCACCTGCTGG - Exonic
1131294866 15:91138788-91138810 TTGGTTCTAGGACTCCCTGCAGG - Intronic
1133707247 16:8366519-8366541 TTTGTTCTGCCTCTACCTCCTGG - Intergenic
1134670451 16:16051005-16051027 TTTGTTCTAGAACTGCCTTCAGG + Intronic
1138709922 16:58960149-58960171 TTTGTTCAACAGGTACCTGCAGG + Intergenic
1139097627 16:63724049-63724071 TTTGTTCTAGAGCCAGGTGCTGG - Intergenic
1139660276 16:68416187-68416209 TGTGTGCCAGCGCTTCCTGCTGG + Intronic
1141218883 16:82050451-82050473 TTTGTTCTAGGGCTACTCCCTGG + Intronic
1146363914 17:32203613-32203635 TATATTCTAGAGCCACCTGCTGG - Intronic
1151999463 17:77636447-77636469 TTTGTTCTGGAGCTCCCTGTTGG - Intergenic
1153382785 18:4456401-4456423 TTTGTTCTACAGCTTCCTGAGGG + Intergenic
928170164 2:28998331-28998353 TGTGTTCTCGAGCTACCAGCAGG + Intronic
928263199 2:29786417-29786439 TTTGTTCAAGTGCAACTTGCTGG - Intronic
931872544 2:66476786-66476808 TTTCTTCTAGGGCTAACTCCGGG - Intronic
937974053 2:127570438-127570460 TTTGCTCCAGAGCTGCCTGCTGG - Intronic
1170277437 20:14607685-14607707 TTTGTTATAACGCTACATGACGG + Intronic
1182320350 22:29474960-29474982 TTTGCTCTAGGGCTTCCTTCTGG - Intergenic
950669641 3:14518397-14518419 TTTGCTCCAGGGCTTCCTGCTGG + Intronic
953857598 3:46511909-46511931 TTTGTTCAAGTGCAACTTGCTGG - Intergenic
954633155 3:52057586-52057608 TTTGTTCTAGCGCTACCTGCGGG - Intergenic
954905845 3:54062177-54062199 GTGGTTCTAGAGCTCCCTGCAGG + Intergenic
955335673 3:58083737-58083759 TTTGTTCCAGAACTATCTGCCGG - Intronic
956601799 3:71030377-71030399 TTTGTTCCAGGGCCACCTACAGG + Intronic
960143337 3:114172479-114172501 TATGTGCTAGCCCTTCCTGCTGG - Intronic
971616876 4:28801929-28801951 TTTATTATAGCTTTACCTGCTGG + Intergenic
979177838 4:117686793-117686815 TTTGTTCAAACACTACCTGACGG + Intergenic
979917202 4:126450900-126450922 TTTGTTATAGGGATATCTGCAGG - Intergenic
982034431 4:151331738-151331760 TTTATTCTAGAGCTTCCTGTTGG - Intergenic
984011636 4:174378753-174378775 TTTGTTCCAGCCATACCAGCTGG + Intergenic
986628031 5:9741172-9741194 TGTGTTCTAGCCCCACCTCCGGG - Intergenic
989256743 5:39374240-39374262 ATTGTTCTACCCCTACCAGCTGG + Intronic
993692678 5:91022182-91022204 TTTTTTCTAGCTTTATCTGCCGG + Intronic
1002887338 6:1309413-1309435 TTTGGTCAAGCTCCACCTGCAGG + Intergenic
1005920847 6:30399435-30399457 TTTTTTTTAGCTGTACCTGCTGG + Intergenic
1015942860 6:138469321-138469343 TTTTCTCTACCGCTTCCTGCAGG - Intronic
1018090825 6:160346291-160346313 TTTCTTCTATCGATACCTTCTGG - Intergenic
1020662551 7:10999192-10999214 TTTCTTCTAGCACAATCTGCTGG + Intronic
1032495921 7:132362232-132362254 TTTGCTGTAGAGCCACCTGCAGG + Intronic
1033280642 7:140004091-140004113 TGTGTTCAATCGCCACCTGCTGG + Intronic
1045136753 8:99229218-99229240 TTTGTTCCAGAGGTCCCTGCTGG - Intronic
1047478760 8:125260474-125260496 TGGGTTCTAGCCCTCCCTGCTGG + Intronic
1186202823 X:7171270-7171292 TTTCTTCTGGCCCTACCTCCAGG - Intergenic
1198186801 X:134260950-134260972 TTTGTTCCAGAGTTTCCTGCTGG - Intergenic