ID: 954633156

View in Genome Browser
Species Human (GRCh38)
Location 3:52057587-52057609
Sequence CTTTGTTCTAGCGCTACCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633156_954633161 30 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 954633161 3:52057640-52057662 GACCTGCAGTGCTTTCCCTACGG 0: 1
1: 1
2: 2
3: 7
4: 155
954633156_954633158 -9 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 954633158 3:52057601-52057623 AGAACAAAGCGGCTAGACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
954633156_954633159 -6 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 954633159 3:52057604-52057626 ACAAAGCGGCTAGACGCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 63
954633156_954633160 8 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633156 Original CRISPR CTTTGTTCTAGCGCTACCTG CGG (reversed) Intergenic
904848920 1:33442160-33442182 CTTAGCCCTAGAGCTACCTGGGG + Intergenic
907349088 1:53811314-53811336 CTTGGTTCTTGCCCCACCTGTGG - Intronic
917567790 1:176230357-176230379 CTTTGTTCTCTGGCTCCCTGAGG - Intergenic
919767868 1:201138948-201138970 CTCTGTTCTTGCTCTAGCTGTGG - Intronic
922729072 1:227940681-227940703 GTTTTTTTTAGCGATACCTGAGG - Intronic
1065977245 10:30853222-30853244 CTTTGTTCTAGCTCATCTTGCGG - Intronic
1071882088 10:89910730-89910752 CTTTGTTCTCTGGCTACTTGAGG + Intergenic
1073490219 10:103848344-103848366 CCTTTTTCTAGCTCTGCCTGGGG - Intronic
1074341191 10:112631741-112631763 TTTTGTTCCAGAGCTTCCTGCGG - Intronic
1075477247 10:122746580-122746602 TGTTGTTCCAGTGCTACCTGTGG + Intergenic
1078537623 11:12187619-12187641 CTTTGTTGTAGCGGTTCCTTGGG + Intronic
1079791768 11:24748005-24748027 CTTTGTTCTTCCCCTTCCTGTGG + Intronic
1081858221 11:46317116-46317138 CTTACTTCTAGCACTGCCTGTGG + Intronic
1097386037 12:58950709-58950731 CTTGGTTCTTCCCCTACCTGTGG + Intergenic
1097465800 12:59923073-59923095 GTGTGTTCTGGCTCTACCTGGGG + Intergenic
1099223512 12:79941456-79941478 CTTGGTTCTAGATCTAGCTGAGG - Intergenic
1099392997 12:82102995-82103017 CTTTGTTCTTCCCCCACCTGTGG - Intergenic
1109326026 13:60869337-60869359 CTTTGTTCTCTGGCTCCCTGAGG + Intergenic
1112973701 13:105291289-105291311 CTCAGTTCTAGAGCTCCCTGTGG - Intergenic
1120603595 14:86543477-86543499 CTTAATTCTAGCCCTACATGAGG + Intergenic
1128385212 15:67142841-67142863 CTGTGTTCCAGCTCTACATGGGG - Exonic
1132730391 16:1358128-1358150 CCTTGCTCTAGCACTGCCTGGGG + Intronic
1134584614 16:15399014-15399036 CTTTGTGCTGGGGCTACCTTGGG + Intronic
1134894185 16:17869952-17869974 CTTTGTTTTAGAGCTACCTTGGG + Intergenic
1141002255 16:80319110-80319132 CATTGTTCTAGAGCTCCCTGGGG - Intergenic
1144724949 17:17497028-17497050 CTCTGTTCTAGCTCTGCCCGCGG - Intergenic
1150564466 17:66326560-66326582 CTTTTTTGTATCCCTACCTGGGG + Intronic
1153382784 18:4456400-4456422 CTTTGTTCTACAGCTTCCTGAGG + Intergenic
1156300843 18:35834618-35834640 CTTTTTTCTTTCCCTACCTGGGG - Intergenic
1161279626 19:3438773-3438795 CTGTGTGCTGGCCCTACCTGAGG + Intronic
1162188574 19:8926889-8926911 CTTTGCACTAGCGATTCCTGGGG - Intronic
1164363813 19:27550371-27550393 CTTTTTTCTAGTGCTTTCTGGGG - Intergenic
925017167 2:538918-538940 CTTTGTTCTCTGGCCACCTGAGG - Intergenic
925922183 2:8645431-8645453 CTTTGTAGTAGCCCCACCTGAGG - Intergenic
929432382 2:41898053-41898075 CTTGGTTCTAGCCCCTCCTGAGG - Intergenic
933835669 2:86243421-86243443 CTCTGTTCTGTGGCTACCTGTGG - Intronic
935822239 2:106905998-106906020 CTCTGTTCAAGGGCTGCCTGGGG + Intergenic
940709440 2:157144267-157144289 CTTGGTTCTTCCCCTACCTGTGG + Intergenic
943050234 2:182905092-182905114 CTTTGATCTAGGGCTTCTTGAGG + Intergenic
946650389 2:221886963-221886985 CTTTTTCCTAGTGCTACCTCTGG + Intergenic
1181911820 22:26244484-26244506 CTCTGTTCTAGAGTTCCCTGTGG - Intronic
1181953634 22:26572421-26572443 CTTGGATCTAGCCATACCTGAGG + Intronic
949887452 3:8707543-8707565 CTTTCTTCTAACTCTAGCTGGGG - Intronic
952348438 3:32510558-32510580 CTTTGTGTTAGGGCTGCCTGGGG - Intergenic
952412251 3:33059982-33060004 TTTTCTTCTAGAGCTACCTCGGG - Intronic
952601485 3:35088867-35088889 CTTTGTTCTTTCCCTGCCTGTGG - Intergenic
953696785 3:45166007-45166029 CCTTGTGCTAGCGTTATCTGGGG + Intergenic
954451546 3:50574344-50574366 CTTGGTTGTAGAGCCACCTGGGG - Intronic
954633156 3:52057587-52057609 CTTTGTTCTAGCGCTACCTGCGG - Intergenic
957483463 3:80828350-80828372 CTTTGTTCTAGCTGTGCATGTGG - Intergenic
959468307 3:106717742-106717764 CTTTATTTTAGAGCTATCTGGGG + Intergenic
960623236 3:119656214-119656236 CTTGTTTCTAGCACTACCTGAGG + Intronic
962897195 3:139726531-139726553 CTCTGTTCTAGCATTTCCTGAGG + Intergenic
965321956 3:167261813-167261835 CTTGGTTCTTCCCCTACCTGTGG + Intronic
966364856 3:179174113-179174135 CTTTATTTTAGCTTTACCTGAGG - Intronic
970513710 4:16806260-16806282 CTCTGTTCTAGCACTTACTGTGG + Intronic
971091565 4:23351890-23351912 CTTATTTCTAGAGCAACCTGGGG - Intergenic
972000926 4:34031472-34031494 CCTTGCTCCAGGGCTACCTGTGG - Intergenic
973858429 4:55036508-55036530 CCTTGTTCCAGTGCTATCTGTGG - Intergenic
979690406 4:123553335-123553357 CTGTGTTCTTGCCCTCCCTGTGG + Intergenic
981246771 4:142549843-142549865 CTTTGTTCCAGAGCTCTCTGAGG + Intronic
995172898 5:109138099-109138121 CTTTGTTCCAGCCCTACATATGG - Intronic
999856178 5:155596806-155596828 CTCTGTTCTTGCTGTACCTGTGG - Intergenic
1000132626 5:158314390-158314412 CTTAGTTCTAGCACAGCCTGTGG - Intergenic
1003605728 6:7558902-7558924 ATTTGTTCTACTACTACCTGGGG + Intronic
1014869871 6:126580655-126580677 CTTTCTTCTAACTCTAACTGTGG + Intergenic
1020611032 7:10398374-10398396 CTTAATTCTAGCCCTAGCTGTGG - Intergenic
1023026609 7:36056527-36056549 CTTTGCTCTAACACTCCCTGTGG - Intergenic
1023531162 7:41155854-41155876 CTTTGCTCTTGCTCTTCCTGCGG - Intergenic
1027904708 7:84164911-84164933 ATATGCTCTAGCGCTACCTTAGG + Intronic
1029111084 7:98213310-98213332 CTTTGTTATAGGGCTACATGGGG + Intergenic
1035306930 7:157939383-157939405 CTCTGTTCTAGCACTTTCTGTGG - Intronic
1037267647 8:17083683-17083705 TTTTGTAATAGGGCTACCTGAGG + Intronic
1037671756 8:21020995-21021017 GTTTGGTTTAGAGCTACCTGTGG - Intergenic
1047621370 8:126611594-126611616 CTTTGTCATAGGGATACCTGTGG - Intergenic
1052163854 9:25297070-25297092 CTTTGTTCTAGCTTTTCTTGAGG - Intergenic
1053300066 9:36942624-36942646 CTTTGTTCTGCCTCTACCAGAGG + Intronic
1056197935 9:84246539-84246561 CTTTGTTCCAGCACTACTTCTGG - Intergenic
1057900951 9:98947780-98947802 ATGTGTTCTACCCCTACCTGAGG - Intronic
1058542059 9:106021744-106021766 CTTTGTCCTGGTGCTGCCTGGGG + Intergenic
1060328493 9:122642508-122642530 CTTTCCTCTAGAGCCACCTGGGG + Intergenic
1060683838 9:125590108-125590130 CTTAGTTCTAGTGCTTCCAGAGG - Intronic
1061153650 9:128844098-128844120 CTCTGTTCTGGCCCTGCCTGGGG + Intronic
1188045962 X:25426393-25426415 CTTGGTTCTACCCCTGCCTGCGG + Intergenic
1189131369 X:38501317-38501339 CTTTGCTCTAGAACTTCCTGTGG + Intronic
1190391350 X:49934912-49934934 CTTTGGTCTGGCCTTACCTGTGG + Intronic
1198589067 X:138155830-138155852 CTCTGTTCTAGCCCTTACTGAGG + Intergenic