ID: 954633160

View in Genome Browser
Species Human (GRCh38)
Location 3:52057618-52057640
Sequence CGCAGGCGGCGCGCTTGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633156_954633160 8 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG No data
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG No data
954633155_954633160 9 Left 954633155 3:52057586-52057608 CCCGCAGGTAGCGCTAGAACAAA No data
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633160 Original CRISPR CGCAGGCGGCGCGCTTGCGT AGG Intergenic