ID: 954633160 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:52057618-52057640 |
| Sequence | CGCAGGCGGCGCGCTTGCGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954633156_954633160 | 8 | Left | 954633156 | 3:52057587-52057609 | CCGCAGGTAGCGCTAGAACAAAG | No data | ||
| Right | 954633160 | 3:52057618-52057640 | CGCAGGCGGCGCGCTTGCGTAGG | No data | ||||
| 954633155_954633160 | 9 | Left | 954633155 | 3:52057586-52057608 | CCCGCAGGTAGCGCTAGAACAAA | No data | ||
| Right | 954633160 | 3:52057618-52057640 | CGCAGGCGGCGCGCTTGCGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954633160 | Original CRISPR | CGCAGGCGGCGCGCTTGCGT AGG | Intergenic | ||