ID: 954633160

View in Genome Browser
Species Human (GRCh38)
Location 3:52057618-52057640
Sequence CGCAGGCGGCGCGCTTGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633156_954633160 8 Left 954633156 3:52057587-52057609 CCGCAGGTAGCGCTAGAACAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 43
954633155_954633160 9 Left 954633155 3:52057586-52057608 CCCGCAGGTAGCGCTAGAACAAA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633160 Original CRISPR CGCAGGCGGCGCGCTTGCGT AGG Intergenic
906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG + Intronic
916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG + Intronic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1067015222 10:42753290-42753312 CGCCGGCGGCGCCTTTGCCTGGG - Intergenic
1067091156 10:43266510-43266532 CGCACGCGGCGGGCGGGCGTGGG - Intronic
1074826880 10:117221090-117221112 GGCAGGAGGGGCGCTTGCTTTGG - Intergenic
1090835290 11:130449392-130449414 CGCCGCCGGCGCGCTAGCATTGG - Exonic
1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG + Intergenic
1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG + Intronic
1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG + Exonic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1121111692 14:91317265-91317287 CCCAGGCTGCACGCTTGCTTTGG - Intronic
1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG + Exonic
1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG + Intronic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1141959193 16:87392828-87392850 CGCCCGCAGCGCGCTTGCGGGGG - Intronic
1144038273 17:11386699-11386721 CTCAGGCGGGGCGCTGGCCTTGG + Intronic
1150168330 17:62966132-62966154 CGGAGGGAGCGCGCGTGCGTGGG - Intergenic
1150216991 17:63476641-63476663 CGCAGGCGCCGCTCGTGCGGCGG - Intergenic
1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG + Intergenic
1161849742 19:6732159-6732181 CGCAGGCGGCGGGGGTGGGTGGG + Intronic
1165510966 19:36266510-36266532 CGGCGGTGGCGCGCTTGCGGCGG - Intergenic
1167532154 19:50024920-50024942 CGCAGGTGGGGCGATTGCCTAGG + Intronic
932757908 2:74421674-74421696 CGCGGGCGGCGCGGTTGCCGGGG - Intronic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG + Intronic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
956414642 3:69013431-69013453 CGCGGGCGGAGTGCGTGCGTAGG + Intronic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG + Intergenic
992089420 5:73303947-73303969 CGCAGGCGGCGCCATTCAGTGGG - Intergenic
996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG + Intergenic
998130324 5:139648507-139648529 AGCAGGCGGCGCGCATGGCTGGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG + Exonic
1023220424 7:37916213-37916235 CGCAGTCGTCGCGCGCGCGTTGG + Exonic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1053411967 9:37921708-37921730 AGCAGGCGGCGCACTCGCTTAGG + Intronic
1187698189 X:21941177-21941199 CGAAGGCGGCGAGCCCGCGTGGG - Intronic
1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG + Intergenic