ID: 954633165

View in Genome Browser
Species Human (GRCh38)
Location 3:52057651-52057673
Sequence CTTTCCCTACGGAGCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633165 Original CRISPR CTTTCCCTACGGAGCCAGGG TGG Intergenic
900415158 1:2531408-2531430 CCTCCCCTAAGGACCCAGGGTGG - Intergenic
900781800 1:4623415-4623437 CTTTGCCTAGGGAGCCGGGCTGG + Intergenic
902689894 1:18104621-18104643 CATTCCCTTGGGAGCCAGGTTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903774634 1:25784985-25785007 CCTACCCTACGGGGTCAGGGAGG + Exonic
906060047 1:42942564-42942586 CTTGCCCTAGGGAGCCACAGGGG - Intronic
906197351 1:43937106-43937128 CTGTCCCTACAGGGCCTGGGCGG - Exonic
907240983 1:53080918-53080940 CTGTCCCGTTGGAGCCAGGGTGG - Intronic
907949621 1:59169791-59169813 CTGTCCCTCTGGAGCCAGGATGG - Intergenic
908751800 1:67430769-67430791 CTTTCCCCACCGCTCCAGGGGGG + Intergenic
911102941 1:94108158-94108180 CTATCATTAAGGAGCCAGGGAGG - Intronic
911589280 1:99728041-99728063 CTTTCTCTAGGGAGGCGGGGAGG - Intronic
914980237 1:152408867-152408889 CTTTCCCTACACAGCCACTGGGG + Intergenic
915125575 1:153661277-153661299 ATTTGCCTGGGGAGCCAGGGGGG - Exonic
915591183 1:156871525-156871547 CTTTCCATCTGGAGCCAGAGGGG + Intronic
920455496 1:206098069-206098091 CTTTCCCAACAGAGTCATGGAGG + Exonic
1069911833 10:71764846-71764868 CTTTCCCTGGGGACCCTGGGTGG - Intronic
1072548274 10:96457253-96457275 CTTTCCCTGAGGAGGCAGGGAGG - Intronic
1073527004 10:104192832-104192854 CCTTCCCCACTGAGCTAGGGTGG + Intronic
1075399257 10:122149734-122149756 CTTTCCCTAGTGAGGCAGAGAGG - Intronic
1076849506 10:133086172-133086194 CTTTCCCTTTGGAGCCTGTGGGG + Intronic
1078098727 11:8316280-8316302 CACTCCCTGGGGAGCCAGGGTGG + Intergenic
1078139931 11:8684718-8684740 CTTTCCCAAAGTAGCCTGGGTGG - Exonic
1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG + Intergenic
1080070429 11:28077651-28077673 CTTTCCCTAGGGGGCCATGGAGG - Intronic
1083981605 11:66175685-66175707 CTTTACTTCTGGAGCCAGGGTGG + Intronic
1086575183 11:88331508-88331530 CTGTCCCTGCGGAGTTAGGGTGG + Intronic
1088881407 11:113976087-113976109 CTCTCCCTACAGAGCTGGGGTGG + Intronic
1091190670 11:133693102-133693124 CTTTTCCTGCTAAGCCAGGGTGG - Intergenic
1091370795 11:135056387-135056409 CTGTCCCTACAGAGCCTGGGAGG - Intergenic
1092443188 12:8527535-8527557 TTTCCCCTGCGGAGCCAGGGAGG - Intergenic
1098625154 12:72656763-72656785 ATTTCTCTAGGGAGTCAGGGAGG - Intronic
1103088070 12:118077336-118077358 CTTTTCCTAGGGTGGCAGGGAGG - Intronic
1103778163 12:123381900-123381922 CTTTCCCTTCGGATCCTTGGGGG + Intergenic
1103911415 12:124354531-124354553 CTGTCCCCACGGGGCCAGGCTGG - Exonic
1105022319 12:132825263-132825285 CTTTACCTGCGGGGCCAGGAGGG - Intronic
1106690282 13:32107756-32107778 CCTGCCCTGAGGAGCCAGGGAGG + Intronic
1106999757 13:35528835-35528857 CTTTTTCTAGGGAGCAAGGGTGG + Intronic
1107250159 13:38350201-38350223 CTTTCCCACCGGAGCCTGCGAGG + Exonic
1109402860 13:61857788-61857810 GTTTCCCTTCTGACCCAGGGCGG + Intergenic
1118744410 14:68763334-68763356 CCATCCCTAGGGAGCCAGGGAGG - Intergenic
1123008902 14:105337859-105337881 ATGTCCCAACGGAGCAAGGGTGG - Intronic
1128559331 15:68654391-68654413 CATTCCTTGCAGAGCCAGGGAGG + Intronic
1132755515 16:1482663-1482685 CTTTCCCCACGGTGCCAGCTGGG + Intergenic
1134068453 16:11245584-11245606 CTTTCCCTGGGGAGCTAGGAAGG + Intergenic
1135564165 16:23499098-23499120 CTTTCACTTGGCAGCCAGGGAGG - Intronic
1135929976 16:26728075-26728097 CTTTCCCTGGGGAAGCAGGGAGG + Intergenic
1139315001 16:66060445-66060467 CTTTCCCTTGGAAGCCAGGCTGG - Intergenic
1141354601 16:83333383-83333405 ATTTCCTTACGGAGCGGGGGTGG + Intronic
1142582322 17:949758-949780 CTTTCCAGACTGAGGCAGGGAGG - Intronic
1142985176 17:3691022-3691044 CTCTCCCTAAGGAACCAGAGAGG + Exonic
1145941512 17:28745479-28745501 CTTTCCCGAGGCAGTCAGGGTGG - Intronic
1148511745 17:48176903-48176925 CTTTCCCTATAGAGACAGTGTGG + Intronic
1148999842 17:51746092-51746114 TTTTCCCTACAGATCCAGGAGGG + Intronic
1149597565 17:57873270-57873292 CTTTCCCAAGGGAGGAAGGGGGG + Intronic
1150249429 17:63698007-63698029 CTTGCCCTGCAGAGGCAGGGTGG + Exonic
1151682066 17:75627517-75627539 CTTTCACTACAGATTCAGGGTGG + Exonic
1152245480 17:79182852-79182874 CTTTCCCGACGCTGCCAGGGAGG + Intronic
1152380660 17:79940939-79940961 CTGTCCCTACGGGGGCACGGTGG - Exonic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1155051793 18:22154926-22154948 CTTTGCCCAGGGAGCCAGCGGGG + Intergenic
1155505292 18:26527094-26527116 CTGTCCCTAAAGAGCCAAGGAGG - Intronic
1160259089 18:77274365-77274387 CTTTGCCTGCAGAGCCTGGGTGG - Exonic
1160887933 19:1360683-1360705 CTTGCCCTCCGGGGTCAGGGAGG + Exonic
1161016569 19:1986448-1986470 CTATCCCCACGGAGGGAGGGCGG + Exonic
1162300630 19:9842917-9842939 CTGTCCCTTCGGGGCAAGGGCGG - Intronic
1167003113 19:46757374-46757396 CTATCGCTTCGGAGCCAGGTGGG + Exonic
1167601799 19:50459094-50459116 CTTTCCCTGCGGGGAGAGGGCGG - Exonic
929934238 2:46282713-46282735 CTTTCCTTCCTGGGCCAGGGAGG - Intergenic
930019628 2:46993675-46993697 CCTTTCCCACGCAGCCAGGGAGG + Intronic
930404904 2:50942479-50942501 CATACCCTACAGAGCCATGGAGG + Intronic
931875544 2:66507905-66507927 CTGTCCCTACGGAGCAAGGCAGG - Intronic
932459345 2:71872480-71872502 CTTCCCCCACAGGGCCAGGGAGG - Intergenic
942426196 2:175863337-175863359 CCTTCCCAACTCAGCCAGGGTGG - Intergenic
944098430 2:195995564-195995586 CTTCCCCTGCTGAGCCAGGTTGG - Intronic
948676044 2:239597339-239597361 CTATCCCTATGGTGCCAGCGAGG + Intergenic
948892983 2:240916132-240916154 CCTTCCCCACGGCTCCAGGGTGG - Intergenic
1171414504 20:24968485-24968507 CTTTCCCTGAGGAGGCAGAGAGG + Intronic
1173240413 20:41290894-41290916 CATTGCCTAAGGAGCCAGGTTGG - Intronic
1174767231 20:53265600-53265622 CTTCCCCGAGGGAGCCAGGGAGG - Intronic
1175148757 20:56916451-56916473 CTTTCCCTGGAGAGCCAGCGAGG + Intergenic
1175903374 20:62368552-62368574 CTTTCTCTACGGAGTCGGGAGGG + Intergenic
1175992935 20:62798374-62798396 CTTTCCAGACAGACCCAGGGAGG - Intronic
1177564787 21:22806256-22806278 CTTTCTCTACTGAGTCAGAGGGG + Intergenic
1178724511 21:35038932-35038954 CATTGCCTAAGGAGCCAGGTGGG + Intronic
1182558757 22:31142905-31142927 CTCTCCCTAGGGAGACAGGCAGG + Intergenic
1182852761 22:33490063-33490085 CTTTCCCTCTGGAGCTAGGGGGG + Intronic
1184785133 22:46667974-46667996 CTGTCCCCACACAGCCAGGGGGG - Intronic
1184876996 22:47282474-47282496 CTTTCCTTACCCAGGCAGGGGGG + Intergenic
1184924903 22:47630097-47630119 CAGCCCCCACGGAGCCAGGGAGG + Intergenic
1185080683 22:48707911-48707933 CTGTCCCCGCGGAGCCCGGGTGG - Intronic
949289804 3:2450965-2450987 CTTTCCCTAGGGAACAAGTGAGG + Intronic
954633165 3:52057651-52057673 CTTTCCCTACGGAGCCAGGGTGG + Intergenic
954869325 3:53755859-53755881 CTTTCACAAAGAAGCCAGGGAGG + Intronic
962314902 3:134353231-134353253 CATTCCCTAGGCTGCCAGGGTGG - Intergenic
962371890 3:134827711-134827733 CTTTCCCTGGGGAGCTGGGGTGG + Intronic
967459406 3:189728079-189728101 CTTTGCCTAAGGATCCAGGATGG + Intronic
967882904 3:194314300-194314322 CATTCCCTACAGCCCCAGGGAGG - Intergenic
969352580 4:6606312-6606334 CTTTCCCTCAGGAGCCACTGGGG - Intronic
969681132 4:8644165-8644187 CCGCCCCTACAGAGCCAGGGTGG - Intergenic
970226073 4:13858125-13858147 TTTCCCCTACTTAGCCAGGGAGG - Intergenic
972458206 4:39274718-39274740 GTTTTCCTACAGAACCAGGGTGG + Intronic
972638912 4:40908470-40908492 CTTTCCTGACGGAGAGAGGGAGG + Intronic
972737653 4:41860392-41860414 ATTTCCCTAGAGAGCCAGCGAGG + Intergenic
973982604 4:56318602-56318624 CTTTCCCAGTGGAGCCAGTGAGG + Intronic
977583516 4:98749387-98749409 CTTTCCCTAGGGACCCTGAGTGG - Intergenic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
990947406 5:61263317-61263339 CTTTCCCTCCCGTGCCTGGGCGG - Intergenic
992263113 5:74990471-74990493 CTTTCCCAAAGTAGCCTGGGTGG + Intergenic
992646799 5:78818936-78818958 CTGCCCCTAAGGAGCCAGAGAGG - Intronic
993575543 5:89595218-89595240 CTTACCCCAAGGAGCCTGGGGGG - Intergenic
1000142674 5:158421249-158421271 CTCTCCCTAAGAAGCCAAGGAGG - Intergenic
1001137502 5:169114790-169114812 CTGCCGCCACGGAGCCAGGGAGG - Intronic
1004631473 6:17425693-17425715 CATTCCCTCCGGACCCAGGGAGG - Intronic
1005098791 6:22146921-22146943 CTTGCCCTGCGGAGCACGGGTGG - Intergenic
1006515879 6:34545302-34545324 CTTTCCAGGAGGAGCCAGGGTGG + Intronic
1016080374 6:139847920-139847942 CTTTCCCCACCCAGACAGGGAGG - Intergenic
1017337795 6:153282568-153282590 CTTTCCCAAAGTAGCCTGGGTGG + Intergenic
1017537726 6:155366449-155366471 CTTTCCCTCCAGAGTCAGAGGGG + Intergenic
1021973203 7:25984967-25984989 TTTTCCCTACAGAGGCAGTGGGG + Intergenic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1025198096 7:56947379-56947401 CTTTGCCGACTGAGCCAGAGGGG - Intergenic
1025673853 7:63629558-63629580 CTTTGCCGACTGAGCCAGAGGGG + Intergenic
1033598753 7:142874459-142874481 CTTTCTCTAGGGAGCTTGGGGGG + Intronic
1034161209 7:148995389-148995411 CTTTCCCAACTGAGGCAAGGTGG - Intergenic
1043487228 8:80710053-80710075 CTTTTCCTACCCAGCCTGGGTGG + Intronic
1047812360 8:128424624-128424646 CTTCCCCCAGGGAGCCAGGAGGG - Intergenic
1049561076 8:143310587-143310609 CTTTCCCTAAGGAGGCAGGAAGG - Intronic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1058538984 9:105992498-105992520 CATTCCCTACCAAGCCAGAGGGG + Intergenic
1061296993 9:129682156-129682178 CTTGCCCCAGGGAGCCAGGTGGG - Intronic
1062468262 9:136691055-136691077 CTCTCCCTAGGGAGTCAGGGAGG + Intergenic
1062725830 9:138073002-138073024 CTTTGCTGACTGAGCCAGGGAGG + Intronic
1185569666 X:1123874-1123896 CTTTCCCTATAGAGTCTGGGTGG - Intergenic
1185722844 X:2395738-2395760 ATTTCCCTGATGAGCCAGGGGGG + Intronic
1191800287 X:65071995-65072017 CTTTCCCAACTTAGCTAGGGAGG - Intergenic
1195352897 X:104011518-104011540 CTTTCTCTACGGAGCCCAAGTGG + Intronic
1198026785 X:132714815-132714837 CCTTCCCTGAGGAGCCAGTGTGG - Intronic