ID: 954633426

View in Genome Browser
Species Human (GRCh38)
Location 3:52058878-52058900
Sequence CAGGCTAATGTGAGGGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633426_954633433 18 Left 954633426 3:52058878-52058900 CCGCCATCCCTCACATTAGCCTG 0: 1
1: 0
2: 0
3: 24
4: 255
Right 954633433 3:52058919-52058941 TCCCTTTAGACTCCTGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 80
954633426_954633435 19 Left 954633426 3:52058878-52058900 CCGCCATCCCTCACATTAGCCTG 0: 1
1: 0
2: 0
3: 24
4: 255
Right 954633435 3:52058920-52058942 CCCTTTAGACTCCTGTAGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 109
954633426_954633432 17 Left 954633426 3:52058878-52058900 CCGCCATCCCTCACATTAGCCTG 0: 1
1: 0
2: 0
3: 24
4: 255
Right 954633432 3:52058918-52058940 CTCCCTTTAGACTCCTGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 79
954633426_954633437 20 Left 954633426 3:52058878-52058900 CCGCCATCCCTCACATTAGCCTG 0: 1
1: 0
2: 0
3: 24
4: 255
Right 954633437 3:52058921-52058943 CCTTTAGACTCCTGTAGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633426 Original CRISPR CAGGCTAATGTGAGGGATGG CGG (reversed) Intergenic
901354895 1:8636785-8636807 AAGGCAAATGTGTGGGCTGGAGG + Intronic
901866805 1:12111801-12111823 CTGGCCACGGTGAGGGATGGGGG + Intronic
902130892 1:14259545-14259567 CAGGCCAATGTGATGGACGGAGG - Intergenic
902649459 1:17827066-17827088 CTGGCTCCTGTGATGGATGGGGG + Intergenic
902708566 1:18223162-18223184 CAGGCTCACGTGAGAGATGGTGG - Intronic
903371229 1:22837412-22837434 CAAGTTTATGAGAGGGATGGGGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
907496751 1:54850480-54850502 CAGGGTCTTGTGAGGGCTGGGGG - Exonic
908121530 1:60990639-60990661 CACCCTAAAGTGAGGGAGGGAGG + Intronic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
916569505 1:166012991-166013013 CTTGCTAATGTGAGAGTTGGAGG + Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
918013562 1:180610582-180610604 CAGGCTAATGGTAGGAATGTTGG + Intergenic
919588028 1:199463455-199463477 CAGGATCTTGTGTGGGATGGAGG - Intergenic
920774169 1:208919931-208919953 CAGGCTAAGATAAGGGAAGGAGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921955988 1:220983751-220983773 CAGGCTCGGCTGAGGGATGGGGG - Intergenic
923538316 1:234870009-234870031 CAGGCTAGGGTGAGGGGTTGAGG - Intergenic
924196076 1:241608517-241608539 GAGGATAATGTGAGGCATGGTGG + Intronic
1063777423 10:9280084-9280106 CAGGTAAATGTGAGCCATGGTGG + Intergenic
1064035899 10:11913176-11913198 CAGTCTAAGGTTAGGAATGGGGG - Intergenic
1065631230 10:27683109-27683131 GATGGTAATGTGAGCGATGGGGG + Intronic
1066656776 10:37704307-37704329 CAAGCTAGTCTGAGGGAGGGAGG + Intergenic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067902593 10:50257873-50257895 CAGGCCAATGTGAGGAAGGAGGG + Intergenic
1068085581 10:52369675-52369697 TAAACTAATGTGGGGGATGGGGG - Intergenic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1071176174 10:82929213-82929235 CATGCTAATGGTAGGGGTGGAGG + Intronic
1072270206 10:93768859-93768881 CACACTAATCTGAGGGTTGGGGG - Intronic
1072886946 10:99285559-99285581 AAGGGAAAGGTGAGGGATGGAGG + Intergenic
1073190315 10:101646377-101646399 CAGGCTAATGGTAGGGAGTGAGG - Intronic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1074778848 10:116785878-116785900 CAGTCTAAGGTGAGGGGAGGGGG - Intergenic
1075867954 10:125743755-125743777 CCGGCAAATGTGAGGAAAGGAGG + Intronic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076834648 10:133014924-133014946 ATGGCTGATGTGATGGATGGGGG + Intergenic
1077118696 11:896984-897006 CAGGCTCGTGTCTGGGATGGAGG - Intronic
1077543538 11:3158953-3158975 CGGGCAAATGTCAGGGATGGGGG + Intronic
1077879431 11:6337160-6337182 CAGGCTGCAGTGAGGCATGGTGG - Intergenic
1078185042 11:9044939-9044961 CAGGCCAAGGTGAGGGGTGAGGG - Intronic
1078667957 11:13341562-13341584 GAGGCCAGTGTGAGGGAGGGTGG - Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1080504474 11:32898843-32898865 CAGGCCAGTGCGAGGCATGGTGG - Intronic
1081078244 11:38703240-38703262 CTGCCAAATGTAAGGGATGGTGG + Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1082805765 11:57448966-57448988 CAGGCTAATTTGAGGAGTGTGGG - Intergenic
1083303661 11:61752227-61752249 GTGGCTAACGAGAGGGATGGGGG + Intergenic
1083992516 11:66255516-66255538 AAGGCCAATGTGAGGGCTGAAGG + Intergenic
1084117683 11:67051519-67051541 CAGAATAAAGTGGGGGATGGTGG + Intergenic
1084513990 11:69625809-69625831 CAGGATAGCGTGAGGGAGGGAGG - Intergenic
1085734217 11:79025153-79025175 CAGGCTAGTGTGAGAGACAGAGG - Intronic
1086299279 11:85407954-85407976 CAGGCTGATCTGAGGGATATGGG + Intronic
1088594218 11:111427915-111427937 CAGTCTAATGTTCGGGGTGGGGG - Intronic
1088780970 11:113133643-113133665 CAGGTTTATGTGTGTGATGGGGG + Intronic
1088800012 11:113296948-113296970 CAGGCTACTGTGAGAAATGGTGG - Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1090332563 11:125943192-125943214 CAGGCTGATGTGAGCCCTGGGGG + Intergenic
1091642678 12:2249590-2249612 AGAGCTAATGTGAGGGTTGGGGG - Intronic
1091873895 12:3917839-3917861 AAGGCTACTGTGAGGATTGGAGG + Intergenic
1092202245 12:6593077-6593099 CAGTCTAAGGTGAGGGCTGAGGG - Exonic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1094707049 12:32924253-32924275 CAGGTTAATGTGTGCCATGGTGG + Intergenic
1096111219 12:49030431-49030453 CAGGTTATTCTGAGGGGTGGGGG + Exonic
1096347873 12:50866447-50866469 GAGGCTGCTGTGAGGGATGGGGG - Intronic
1096398006 12:51281316-51281338 CAGCCTTACGGGAGGGATGGAGG - Exonic
1096966199 12:55629937-55629959 CAGGCTAAAGTGGGGTGTGGTGG + Intergenic
1097483225 12:60158549-60158571 CAGCCTAATGTGAGGGTAGCTGG - Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1098119733 12:67223205-67223227 CAGGATAGTCTGTGGGATGGAGG + Intergenic
1098420277 12:70288872-70288894 CATGGTAATTTTAGGGATGGTGG + Intronic
1098960933 12:76739162-76739184 GTGGCTGATGTGGGGGATGGGGG + Intergenic
1099777425 12:87151344-87151366 GTGGCTACTGTGGGGGATGGGGG + Intergenic
1103326890 12:120127650-120127672 CAGGAAAAGGTGAGAGATGGAGG + Exonic
1103401200 12:120644061-120644083 GAGGCTAAGGTGTGGAATGGTGG + Intronic
1105908247 13:24835141-24835163 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1106387358 13:29301119-29301141 CTAGCTGATGTGAGGGATGAGGG + Intronic
1107756013 13:43622932-43622954 GAGGCTACTTTCAGGGATGGGGG + Intronic
1107986062 13:45777178-45777200 CAGGCTACTGTGCGGCATGAAGG - Intergenic
1115376141 14:32677930-32677952 CATGCAAATGTGTGGGTTGGAGG + Intronic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1118739716 14:68730916-68730938 GAGGTGAAAGTGAGGGATGGGGG - Intergenic
1120394759 14:83955116-83955138 CAGTCTATTTTGAGGGTTGGAGG - Intergenic
1121336787 14:93082549-93082571 CTGGCTCATGCCAGGGATGGGGG + Intronic
1121828150 14:97027560-97027582 CAGGGGAGTGTGTGGGATGGGGG + Intergenic
1123476002 15:20592904-20592926 CAGGCTACTGTGAGGCAGGGAGG + Intergenic
1123642009 15:22407459-22407481 CAGGCTACTGTGAGGCAGGGAGG - Intergenic
1124557126 15:30736422-30736444 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1124674137 15:31669323-31669345 GAGGCTGCTGTGGGGGATGGGGG + Intronic
1126692424 15:51297952-51297974 TAGGCTACTCTGAGGAATGGGGG + Intronic
1129466817 15:75728718-75728740 CAGGCCAGTGTGAGGCATGGAGG + Intergenic
1129693934 15:77730001-77730023 CAGGTAAATGTGGGGGACGGAGG - Intronic
1129857836 15:78837657-78837679 CAGGCTGCTGTGAGAGGTGGGGG - Intronic
1131219493 15:90570289-90570311 CAGGTGGGTGTGAGGGATGGAGG + Intronic
1131747439 15:95464259-95464281 CTGGCCAATGTGAGGAAAGGAGG - Intergenic
1135943863 16:26846669-26846691 CAAGCAAATGTGAGTGATGGAGG + Intergenic
1136023099 16:27452429-27452451 CAGGAGAATCTGAGAGATGGAGG + Intergenic
1139287130 16:65825741-65825763 CAGGATAGTGTGAGGGCTGAGGG + Intergenic
1140047708 16:71453547-71453569 GAGGCAAATGTGGGGGTTGGGGG + Intronic
1142910870 17:3089713-3089735 GTGGCCACTGTGAGGGATGGGGG + Intergenic
1143480447 17:7224902-7224924 CAAGCTCAGGTGAGGGCTGGAGG + Intronic
1144024705 17:11267793-11267815 CAGGCTTATCTGAGAGAGGGAGG + Intronic
1144362650 17:14509846-14509868 CAGGCCAATGTGAGTGCTTGGGG - Intergenic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1146269086 17:31472730-31472752 CAGACAGAAGTGAGGGATGGAGG + Intronic
1146507682 17:33419354-33419376 GAGGCTCATTTGAGGGATGAAGG + Intronic
1148291971 17:46460140-46460162 CAGGCTAGTGGGAGTAATGGGGG + Intergenic
1148314161 17:46677831-46677853 CAGGCTAGTGGGAGTAATGGGGG + Intronic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1150455687 17:65304937-65304959 CAGCCTCAAGTGTGGGATGGGGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151568978 17:74916547-74916569 CAAGCTGAGGTCAGGGATGGGGG + Exonic
1151945857 17:77319529-77319551 CAGACTAATGGGACGGAGGGGGG + Intronic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152450910 17:80379286-80379308 CAGGCTAGTGTGATAGATGGAGG + Intronic
1152491902 17:80640670-80640692 CAGGATGTTGTGAGGGATGCAGG + Intronic
1153255339 18:3164504-3164526 AAGGCTAAGGAGAGGAATGGAGG - Intronic
1153713819 18:7825494-7825516 CAGGTGTTTGTGAGGGATGGAGG + Intronic
1154297878 18:13165990-13166012 GCGGCTGCTGTGAGGGATGGGGG - Intergenic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1156676504 18:39532672-39532694 CAGGTCAATGTCAGAGATGGGGG + Intergenic
1157297956 18:46459525-46459547 CAGGCTAATATTAGGGACTGGGG + Exonic
1157446573 18:47750950-47750972 CACGGTTATGTGAGGGCTGGTGG - Intergenic
1158829757 18:61264131-61264153 GAAGCTACTGTGGGGGATGGGGG - Intergenic
1159241610 18:65750372-65750394 CAGGCTAAGGTGGGTGTTGGAGG + Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159846046 18:73461292-73461314 CAGGTTAATGTGATGAATTGAGG + Intergenic
1159899913 18:74036425-74036447 CTGGCTGATGGCAGGGATGGAGG - Intergenic
1162150903 19:8645015-8645037 GAGGCTGAGGTGGGGGATGGGGG - Intergenic
1162203089 19:9035423-9035445 CAGGATGATGTGGAGGATGGGGG - Intergenic
1164444995 19:28309342-28309364 GAGGCTAATGTCAGGAGTGGAGG - Intergenic
1164800778 19:31074379-31074401 GAGTTTAATGTGAGGGATCGGGG - Intergenic
1165417666 19:35704674-35704696 CAGGCAAATCTGGGGTATGGGGG + Intronic
1168124686 19:54276936-54276958 CACGATGATGTCAGGGATGGGGG + Intronic
1168177300 19:54634612-54634634 CACGATGATGTCAGGGATGGGGG - Intronic
925207895 2:2022817-2022839 CAGGCACATGTGATGGAAGGCGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
927123691 2:19993416-19993438 CATCTTAGTGTGAGGGATGGGGG + Intronic
927445917 2:23161460-23161482 CATGGTAATTTTAGGGATGGAGG + Intergenic
927630510 2:24769835-24769857 CAGACAAAGGTGAGTGATGGGGG - Exonic
929405922 2:41640808-41640830 CAGGATAAAGTGAGGGGTGGGGG - Intergenic
930237520 2:48902334-48902356 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930237717 2:48903714-48903736 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930887221 2:56340075-56340097 CATGTTAATGTCAGTGATGGGGG + Intronic
930933640 2:56919780-56919802 CAGGCAGATGTGAGGGAGAGGGG + Intergenic
932864294 2:75325352-75325374 CAGCCTCATGTGTGGGAAGGGGG + Intergenic
934654420 2:96109876-96109898 CAGGCTCATGGGCAGGATGGCGG - Intergenic
935832138 2:107011312-107011334 CAGGATAATGTGAGGAAGGGCGG - Intergenic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
936854343 2:116938359-116938381 CAGGCAAATGTGGGCCATGGGGG + Intergenic
937229953 2:120392324-120392346 GAGGCTTGTGAGAGGGATGGCGG + Intergenic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
937843817 2:126555222-126555244 CCAGCTAATGCAAGGGATGGTGG + Intergenic
939118384 2:138087920-138087942 CAGGCTAAAGGGAGTGAAGGGGG + Intergenic
942427777 2:175877528-175877550 CAGGCTAGAGTGGGGGGTGGGGG + Intergenic
942731836 2:179068898-179068920 CTGGCTAATGTGAATGATGAAGG - Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944925568 2:204460586-204460608 CAAGATAATGTGAGGAAAGGTGG + Intergenic
947223884 2:227821683-227821705 CAGGAGAATGGGAGGGCTGGAGG + Intergenic
947879069 2:233489294-233489316 CTGGCTGGTGTGAGGGATGGAGG - Intronic
948713976 2:239847101-239847123 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
948728624 2:239949767-239949789 CAGGCCAGTGTCAGGTATGGTGG - Intronic
1170554413 20:17504166-17504188 CATGGTCATGTGGGGGATGGGGG - Intronic
1172216003 20:33236172-33236194 CTGGCCAATGTCAGGGATGTGGG + Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173614660 20:44394899-44394921 CAGGCTAAGGACAGGGAGGGAGG + Intronic
1173946130 20:46952288-46952310 GAGGCCAGTGTGAGAGATGGAGG + Intronic
1174500548 20:50981072-50981094 CAGGCTAAAGTCAGGGTTAGAGG + Intergenic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1175746803 20:61462700-61462722 CAGGCCAATGACAAGGATGGAGG - Intronic
1177231644 21:18328626-18328648 AAGGCTACTGGGAGGGGTGGTGG + Intronic
1177485669 21:21752179-21752201 TAGGATAAAGTGTGGGATGGAGG + Intergenic
1177959147 21:27640313-27640335 CAGGATATTGGGAGGGAAGGAGG - Intergenic
1178038201 21:28608876-28608898 GTGGCTGCTGTGAGGGATGGGGG - Intergenic
1178804147 21:35824516-35824538 CTGGCTAGTGAGTGGGATGGTGG - Intronic
1179056787 21:37943801-37943823 CAGGCTCAGGGGAGAGATGGAGG - Intergenic
1179278780 21:39916016-39916038 CAGGCTGATTGGAGGGATAGAGG - Intronic
1179838548 21:44054780-44054802 CAGGCTAGTGGGAGGGATAGAGG + Intronic
1181319800 22:21995487-21995509 CAGGCCAATGTGGGAGATGCAGG + Intergenic
1182123400 22:27800685-27800707 CCGCCTGATGTGAGGGACGGGGG + Exonic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182651084 22:31851782-31851804 CAAGCAAACGTGAGGTATGGTGG + Intronic
1183440091 22:37818172-37818194 CAGGCAAATGGGTGGGCTGGAGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183649918 22:39147984-39148006 CAGGCTACTGTGAGGGTGAGAGG - Intronic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1185146507 22:49139921-49139943 CAGGCCAGTGTGAGGGCTGCAGG - Intergenic
949454555 3:4224918-4224940 CAGGCAACTGGGAAGGATGGTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952344861 3:32473902-32473924 CATGGTAAAGGGAGGGATGGAGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956681626 3:71786198-71786220 CAGGCTAGGATGAGAGATGGAGG - Intergenic
956791398 3:72682952-72682974 TTAGCTAGTGTGAGGGATGGTGG - Intergenic
957861000 3:85948973-85948995 CATGGAAATGTGAGGCATGGTGG + Intronic
959144321 3:102525478-102525500 AGGACTAATGAGAGGGATGGAGG - Intergenic
961315513 3:126032772-126032794 CATTCTAATGTGATGGATGGGGG + Intronic
961576654 3:127842343-127842365 CAGGAAAATGTCAGGGAAGGGGG - Intergenic
966496058 3:180582050-180582072 CAGGCTTAGGGGAGGAATGGAGG + Intergenic
967876315 3:194270614-194270636 CAGGCTTGTGTGAGGGGTGGAGG - Intergenic
968566928 4:1318012-1318034 CAGGCTCATGTGACGGACAGTGG + Intronic
968654890 4:1774151-1774173 CTGGCTCATGGGAAGGATGGGGG + Intergenic
969687148 4:8682066-8682088 CAGGCTCATGTGGGGAGTGGAGG - Intergenic
970172752 4:13305740-13305762 CAGGCGGATGGGAGTGATGGTGG - Intergenic
971318854 4:25589116-25589138 CTGGCTAATGACAGGGGTGGGGG + Intergenic
971576389 4:28280466-28280488 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
971834081 4:31738998-31739020 AAGGACAATGTGATGGATGGTGG + Intergenic
974107540 4:57487256-57487278 CAGGGGAATGTGAGGGTTGAGGG - Intergenic
976168193 4:82276764-82276786 CAGCCTTAAGGGAGGGATGGAGG + Intergenic
976896126 4:90114596-90114618 TAGGCTAATGTGTGGGTTTGTGG - Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
979429732 4:120614584-120614606 CAGGCTCCTGTGATGTATGGTGG + Intergenic
980172150 4:129302847-129302869 AAGGGTAATGGGTGGGATGGGGG + Intergenic
987663017 5:20902077-20902099 CAGTCTACTCTGAGGGAGGGAGG + Intergenic
989579709 5:43020494-43020516 CAGGCTAATGGGAGTGCTGAAGG + Intergenic
990439457 5:55830107-55830129 CAGGCGAGTGAGAGGGCTGGAGG + Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993386398 5:87267954-87267976 CAGGCAGATGAGAGGGGTGGGGG - Exonic
997987788 5:138517470-138517492 CAGGTAAGTGGGAGGGATGGGGG + Intronic
998825960 5:146101553-146101575 CAGGGTAGTGTGCGGGATAGTGG - Intronic
999367084 5:151030150-151030172 AAGGCTACTGTGAGTGGTGGTGG + Exonic
999715422 5:154356354-154356376 CAGGGTACTGTGAGGGCTGGGGG + Intronic
1002170057 5:177369923-177369945 CAGCCTGATGTGGGGGTTGGGGG - Intronic
1002449450 5:179310557-179310579 CCGGCTGGGGTGAGGGATGGTGG + Intronic
1002868282 6:1143355-1143377 CAGGCTAATGTGTGTGTTTGTGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1006300334 6:33190681-33190703 CAGGCTTAGGTGGGGGTTGGGGG - Intronic
1006314849 6:33284492-33284514 CTGGCTGATGTGAGGGGTGGAGG - Intronic
1006737834 6:36287306-36287328 CAGGCTATTGTGAGAGGAGGAGG + Intronic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1014083018 6:117309929-117309951 CAAGCTAAAGTGAGAGTTGGTGG - Intronic
1014351868 6:120355675-120355697 CATGCCAATGTGAGGGACTGGGG + Intergenic
1015405944 6:132836889-132836911 GAGTCTAATGTGAGGGAGTGAGG - Intergenic
1015497708 6:133897996-133898018 CATGCTAATGAGATGGCTGGTGG - Intergenic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1018542563 6:164898236-164898258 CCGGCGAATGATAGGGATGGAGG - Intergenic
1019948169 7:4346870-4346892 CAGGATAAAGTGAGGCACGGAGG - Intergenic
1020099071 7:5384500-5384522 CATGCGAATGTGAGGGAGGGAGG - Intronic
1020210726 7:6156244-6156266 CAGGCACATGGGAGGGAAGGAGG + Intronic
1020634897 7:10685011-10685033 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
1020991519 7:15202567-15202589 CTGACTAATGTGAAGGATGATGG - Intronic
1021397241 7:20165467-20165489 GATGGTACTGTGAGGGATGGAGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1024350693 7:48359660-48359682 CGGGCTGATGTGAGAGGTGGTGG + Intronic
1033082907 7:138314617-138314639 CAAGCTAAGGCCAGGGATGGTGG + Intergenic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033936876 7:146596650-146596672 GGGGCTAATGTGAGCCATGGTGG + Intronic
1034790408 7:153963156-153963178 GAAGCTAATGTGAGGGTAGGAGG + Intronic
1035032367 7:155869899-155869921 CAGGCTCGTGGCAGGGATGGAGG + Intergenic
1038409422 8:27346577-27346599 CATGCTGCTGTGAGTGATGGAGG + Intronic
1038690128 8:29753771-29753793 CTGACTAATGTGGGGGAAGGTGG - Intergenic
1039709681 8:40043045-40043067 GAGGCTGATGTGAGCTATGGTGG + Intergenic
1043300588 8:78726087-78726109 AAGGGAAATGTGAGGGAGGGTGG + Intronic
1045773257 8:105770509-105770531 CACGATAATGTGGGGGTTGGGGG - Intronic
1046247303 8:111581326-111581348 TAGGCAAATGTGTGGCATGGAGG + Intergenic
1048985655 8:139733434-139733456 CAGGCTAAGATGTGGGGTGGGGG + Intronic
1049316190 8:141969683-141969705 CAGGCTAATTTGGGGAAGGGAGG - Intergenic
1050701749 9:8347524-8347546 GAGGCAAATGTGAAGGATGCTGG + Intronic
1050746126 9:8878382-8878404 GGGGCTAAGGTGGGGGATGGTGG + Intronic
1050785560 9:9396640-9396662 CAGTCTAGTCTGAGGGAAGGGGG + Intronic
1061534923 9:131241651-131241673 CAGGCTAAGGGCAGGCATGGTGG + Intergenic
1185491193 X:518239-518261 CAGGCTGAGGTGGAGGATGGAGG - Intergenic
1186747154 X:12581938-12581960 GAGGCTAATGAGAAGTATGGAGG - Intronic
1186791738 X:13006238-13006260 CAGGGTAATTTCTGGGATGGAGG + Intergenic
1187920803 X:24199581-24199603 GAGGCTAATTTGAGAAATGGAGG + Intronic
1188369503 X:29351415-29351437 TAGGCTATTGTGAGGGTTTGAGG + Intronic
1193954653 X:87844681-87844703 GTGGCCACTGTGAGGGATGGGGG + Intergenic
1194466212 X:94237689-94237711 GTGGCTGCTGTGAGGGATGGGGG + Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195781511 X:108470719-108470741 AAGGCTAATGTCCAGGATGGTGG + Intronic
1197132399 X:123020133-123020155 GTGGCTGTTGTGAGGGATGGGGG - Intergenic
1197545198 X:127815768-127815790 GTGGCTACTGTGGGGGATGGAGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199721127 X:150543418-150543440 AAGGCCAGTGTGAGGGAGGGAGG + Intergenic