ID: 954633840

View in Genome Browser
Species Human (GRCh38)
Location 3:52060983-52061005
Sequence CTAGGTGACTAGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633840_954633847 6 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633840_954633846 -4 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data
954633840_954633849 24 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633849 3:52061030-52061052 GCTGGTATCTCCATAGCAACAGG No data
954633840_954633850 30 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633840 Original CRISPR CTAGGTGACTAGAGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr