ID: 954633846 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:52061002-52061024 |
Sequence | CTAGGCTCACATTGTCCTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
954633837_954633846 | 24 | Left | 954633837 | 3:52060955-52060977 | CCAAGCTGGCGGGATGCACGGTC | No data | ||
Right | 954633846 | 3:52061002-52061024 | CTAGGCTCACATTGTCCTATTGG | No data | ||||
954633838_954633846 | 2 | Left | 954633838 | 3:52060977-52060999 | CCTCTCCCCTCAGCCCTCTAGTC | No data | ||
Right | 954633846 | 3:52061002-52061024 | CTAGGCTCACATTGTCCTATTGG | No data | ||||
954633839_954633846 | -3 | Left | 954633839 | 3:52060982-52061004 | CCCCTCAGCCCTCTAGTCACCTA | No data | ||
Right | 954633846 | 3:52061002-52061024 | CTAGGCTCACATTGTCCTATTGG | No data | ||||
954633841_954633846 | -5 | Left | 954633841 | 3:52060984-52061006 | CCTCAGCCCTCTAGTCACCTAGG | No data | ||
Right | 954633846 | 3:52061002-52061024 | CTAGGCTCACATTGTCCTATTGG | No data | ||||
954633840_954633846 | -4 | Left | 954633840 | 3:52060983-52061005 | CCCTCAGCCCTCTAGTCACCTAG | No data | ||
Right | 954633846 | 3:52061002-52061024 | CTAGGCTCACATTGTCCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
954633846 | Original CRISPR | CTAGGCTCACATTGTCCTAT TGG | Intergenic | ||
No off target data available for this crispr |