ID: 954633846

View in Genome Browser
Species Human (GRCh38)
Location 3:52061002-52061024
Sequence CTAGGCTCACATTGTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633837_954633846 24 Left 954633837 3:52060955-52060977 CCAAGCTGGCGGGATGCACGGTC No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data
954633838_954633846 2 Left 954633838 3:52060977-52060999 CCTCTCCCCTCAGCCCTCTAGTC No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data
954633839_954633846 -3 Left 954633839 3:52060982-52061004 CCCCTCAGCCCTCTAGTCACCTA No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data
954633841_954633846 -5 Left 954633841 3:52060984-52061006 CCTCAGCCCTCTAGTCACCTAGG No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data
954633840_954633846 -4 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633846 3:52061002-52061024 CTAGGCTCACATTGTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633846 Original CRISPR CTAGGCTCACATTGTCCTAT TGG Intergenic
No off target data available for this crispr