ID: 954633847

View in Genome Browser
Species Human (GRCh38)
Location 3:52061012-52061034
Sequence ATTGTCCTATTGGCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633838_954633847 12 Left 954633838 3:52060977-52060999 CCTCTCCCCTCAGCCCTCTAGTC No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633840_954633847 6 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633841_954633847 5 Left 954633841 3:52060984-52061006 CCTCAGCCCTCTAGTCACCTAGG No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633844_954633847 -2 Left 954633844 3:52060991-52061013 CCTCTAGTCACCTAGGCTCACAT No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633839_954633847 7 Left 954633839 3:52060982-52061004 CCCCTCAGCCCTCTAGTCACCTA No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data
954633843_954633847 -1 Left 954633843 3:52060990-52061012 CCCTCTAGTCACCTAGGCTCACA No data
Right 954633847 3:52061012-52061034 ATTGTCCTATTGGCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633847 Original CRISPR ATTGTCCTATTGGCTGTTGC TGG Intergenic
No off target data available for this crispr