ID: 954633850

View in Genome Browser
Species Human (GRCh38)
Location 3:52061036-52061058
Sequence ATCTCCATAGCAACAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954633845_954633850 12 Left 954633845 3:52061001-52061023 CCTAGGCTCACATTGTCCTATTG No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data
954633840_954633850 30 Left 954633840 3:52060983-52061005 CCCTCAGCCCTCTAGTCACCTAG No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data
954633843_954633850 23 Left 954633843 3:52060990-52061012 CCCTCTAGTCACCTAGGCTCACA No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data
954633841_954633850 29 Left 954633841 3:52060984-52061006 CCTCAGCCCTCTAGTCACCTAGG No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data
954633844_954633850 22 Left 954633844 3:52060991-52061013 CCTCTAGTCACCTAGGCTCACAT No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data
954633848_954633850 -4 Left 954633848 3:52061017-52061039 CCTATTGGCTGTTGCTGGTATCT No data
Right 954633850 3:52061036-52061058 ATCTCCATAGCAACAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954633850 Original CRISPR ATCTCCATAGCAACAGGTTC TGG Intergenic
No off target data available for this crispr