ID: 954634665

View in Genome Browser
Species Human (GRCh38)
Location 3:52065016-52065038
Sequence GGAAGGGCCTGGAGCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954634652_954634665 21 Left 954634652 3:52064972-52064994 CCCCCTGCTCAAAATTTCTGATC No data
Right 954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG No data
954634653_954634665 20 Left 954634653 3:52064973-52064995 CCCCTGCTCAAAATTTCTGATCT No data
Right 954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG No data
954634654_954634665 19 Left 954634654 3:52064974-52064996 CCCTGCTCAAAATTTCTGATCTT No data
Right 954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG No data
954634655_954634665 18 Left 954634655 3:52064975-52064997 CCTGCTCAAAATTTCTGATCTTT No data
Right 954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954634665 Original CRISPR GGAAGGGCCTGGAGCCCAGG TGG Intergenic
No off target data available for this crispr