ID: 954635192

View in Genome Browser
Species Human (GRCh38)
Location 3:52067342-52067364
Sequence CTGGGTCACCAGGACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954635186_954635192 11 Left 954635186 3:52067308-52067330 CCACGGGGAAGAAACATCAGCGT No data
Right 954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG No data
954635184_954635192 23 Left 954635184 3:52067296-52067318 CCTGCTCTTCTCCCACGGGGAAG No data
Right 954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG No data
954635185_954635192 12 Left 954635185 3:52067307-52067329 CCCACGGGGAAGAAACATCAGCG No data
Right 954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG No data
954635180_954635192 30 Left 954635180 3:52067289-52067311 CCACTCACCTGCTCTTCTCCCAC No data
Right 954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954635192 Original CRISPR CTGGGTCACCAGGACCCAGC TGG Intergenic
No off target data available for this crispr