ID: 954637636

View in Genome Browser
Species Human (GRCh38)
Location 3:52079854-52079876
Sequence CTGCTGACCTTGGAGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954637627_954637636 22 Left 954637627 3:52079809-52079831 CCCTCTTGCTGGGGTCCAACTCT 0: 1
1: 0
2: 0
3: 18
4: 182
Right 954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG 0: 1
1: 0
2: 3
3: 16
4: 261
954637626_954637636 30 Left 954637626 3:52079801-52079823 CCAGAACTCCCTCTTGCTGGGGT 0: 1
1: 0
2: 3
3: 17
4: 132
Right 954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG 0: 1
1: 0
2: 3
3: 16
4: 261
954637630_954637636 7 Left 954637630 3:52079824-52079846 CCAACTCTTCCACAGTGCGGCCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG 0: 1
1: 0
2: 3
3: 16
4: 261
954637628_954637636 21 Left 954637628 3:52079810-52079832 CCTCTTGCTGGGGTCCAACTCTT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG 0: 1
1: 0
2: 3
3: 16
4: 261
954637631_954637636 -2 Left 954637631 3:52079833-52079855 CCACAGTGCGGCCCCTTCTGTCT 0: 1
1: 0
2: 1
3: 24
4: 188
Right 954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG 0: 1
1: 0
2: 3
3: 16
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954637636 Original CRISPR CTGCTGACCTTGGAGAAACC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900651856 1:3733714-3733736 TTGCTGAAATTGGAGAAAACTGG + Exonic
900914247 1:5623649-5623671 GTGCTGGCCATGGAGAAATCGGG - Intergenic
901207013 1:7503215-7503237 CTGCTGCCCTTGGAGAGTCAGGG + Intronic
904292261 1:29495524-29495546 CTGGGGTCCTTGGAGAAATCTGG - Intergenic
904471484 1:30739304-30739326 CTGTTGTCCTTGAAGAGACCGGG - Intronic
906125412 1:43424254-43424276 TTGCTGACATTGGAGCCACCAGG + Exonic
906191146 1:43900200-43900222 CTGCTGTCCCTGCAGAACCCAGG - Intronic
906285578 1:44585514-44585536 TTGCTGACCTTGGCAAAAGCAGG - Intronic
907010345 1:50957543-50957565 CTGGTGAACATGGCGAAACCCGG - Intronic
907045797 1:51299398-51299420 CAGCTGACCTCGGAGGATCCTGG + Intronic
908028447 1:59974900-59974922 GTGATGACCTTCTAGAAACCAGG - Intergenic
910236981 1:85047302-85047324 ATGCTGACCTTGGAAAAGTCAGG + Intronic
910416194 1:87001801-87001823 CTGATCAACATGGAGAAACCTGG - Intronic
910449638 1:87332007-87332029 CTGCAGACCATGGTGAATCCGGG + Exonic
911512473 1:98824629-98824651 CTGCTTAACCTGGAGAAACCAGG + Intergenic
912813217 1:112809501-112809523 ACGCTGACCTTCAAGAAACCTGG - Intergenic
915112301 1:153571830-153571852 CTGGTGACGTAGGAGAAAGCTGG - Intergenic
915312339 1:155010957-155010979 CTGCTGCTCCTGGAGAAGCCTGG + Exonic
917271248 1:173277047-173277069 CTGCTGGCCTTACAGACACCTGG - Intergenic
917704497 1:177618344-177618366 CTGCTGTCTTTGGACATACCAGG - Intergenic
917747090 1:178020870-178020892 CTGCTGCCCTTGGTGTAATCGGG - Intergenic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
918833846 1:189434206-189434228 CCTCTGTCCTTTGAGAAACCTGG + Intergenic
918962890 1:191303246-191303268 CTGCTGGACCTGGAGAAAGCAGG - Intergenic
920332749 1:205222666-205222688 CTGATCAACATGGAGAAACCCGG + Intergenic
920969172 1:210727988-210728010 CTGCTGACCATAGAGAACACAGG - Intronic
922746851 1:228049031-228049053 CTGCTGACATTGGAGCTGCCTGG - Intronic
923208106 1:231777965-231777987 CTGATGGCCTGGGAGAGACCAGG + Intronic
1063042053 10:2352038-2352060 CCGCAGACCTTGGACAAAGCTGG + Intergenic
1067249319 10:44574001-44574023 CTGCTGACCCTGGAGCTGCCTGG - Intergenic
1067691137 10:48503051-48503073 CTCCTGACCTTGGAGAAGCCAGG + Intronic
1068868383 10:61918409-61918431 CTGCAGACCTAGGATAAGCCAGG - Intronic
1069112642 10:64465752-64465774 CTCCTGTCCATGGAGAGACCAGG - Intergenic
1070276976 10:75016708-75016730 CAGCTCTCCCTGGAGAAACCTGG - Intronic
1070796033 10:79216861-79216883 CTCCTGACCTTGCAGTAAGCAGG + Intronic
1073657638 10:105434516-105434538 CTTCTCACCCTGGAGAAATCTGG + Intergenic
1076507334 10:130986879-130986901 CTGCTGCTCTTGGAGGACCCCGG - Intergenic
1076874852 10:133210984-133211006 CTGCTGACCTGGGAGGAAAGCGG + Intronic
1077890516 11:6414863-6414885 TGCCTGACCTTTGAGAAACCTGG - Intronic
1078532205 11:12145457-12145479 ATGCTGGCCCTGGAGAAAGCAGG + Intronic
1079737824 11:24019215-24019237 CTCCTGACCATGGATAATCCTGG - Intergenic
1080243117 11:30150163-30150185 CTAGTGACCTTGGAGAGAGCAGG + Intergenic
1081760154 11:45571341-45571363 TTGCTGACTTTGGCCAAACCAGG + Intergenic
1082821620 11:57547891-57547913 GTGCTGGCATAGGAGAAACCAGG - Intronic
1084114924 11:67036881-67036903 CTGCCCAACATGGAGAAACCTGG + Intronic
1084647216 11:70465500-70465522 CTCCTGGCCTTGGAGCCACCTGG - Intergenic
1086177322 11:83907005-83907027 CTGCAGACCTTGGAAGAAACTGG - Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1089080443 11:115772191-115772213 CTGCTGACCTTGGTGACAGTAGG + Intergenic
1089082399 11:115787914-115787936 CTGCTGACCTTGGGGGAAGAAGG + Intergenic
1090077621 11:123589406-123589428 CTGTTTACCTGGGAGAATCCAGG + Intronic
1091160225 11:133413193-133413215 CTGGAGACTTTGGAGAAGCCGGG + Intronic
1091848632 12:3677645-3677667 CTGTTGTCCTTGGAGAAGCTGGG + Intronic
1092512427 12:9170920-9170942 CTGCTGGCTTTGGAGAATACAGG + Intronic
1093210608 12:16303678-16303700 CTCCGGACCTTGGAGAAAAGTGG + Intergenic
1097036392 12:56127579-56127601 CGACTGACCCTGGAGAAAACTGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104903395 12:132201254-132201276 CTTCTGGCCTTGCAGAACCCAGG - Exonic
1105335019 13:19459558-19459580 CTGCTGGCTTTGGAGAATACAGG - Intronic
1105859905 13:24399830-24399852 CTGCTGGCTTTGGAGAATACAGG + Intergenic
1106387598 13:29302724-29302746 CTGCTGACTTTGGAGAAGACAGG + Intronic
1106548346 13:30750010-30750032 CTGCTGACGTTTGAGAACCACGG - Intronic
1109439400 13:62349647-62349669 CTGCTGGCTTTGGAGAATACAGG + Intergenic
1110333780 13:74302741-74302763 CTGCTTGGCTTGGAGAAAGCAGG + Intergenic
1113559587 13:111267544-111267566 CTGCTGAGCTTCGGGCAACCTGG - Exonic
1113705575 13:112430616-112430638 CGGCTGAGCTGGGAGAACCCAGG - Intronic
1114488388 14:23079007-23079029 CTGCTGTCCCTGGAGACTCCAGG + Exonic
1117306590 14:54482621-54482643 ATCCTGACCTTGGAGAAGCCAGG - Intronic
1118716867 14:68566086-68566108 CTGCTTAACCTGGAGAAATCAGG - Intronic
1121051564 14:90822287-90822309 CTGATGAACGTGGAGAAACCCGG + Intergenic
1124384151 15:29192395-29192417 CTGCTGAGGATGGAGAAAGCTGG + Intronic
1125001035 15:34770178-34770200 CTGCTGGTCATGGAAAAACCGGG - Intergenic
1125731238 15:41893817-41893839 CTGCTTACCTTGGTGATGCCTGG + Intronic
1125731253 15:41893891-41893913 CTGCTTACCTTGGTGATGCCTGG + Exonic
1125969587 15:43901076-43901098 CTGGTGTCTTTGGAGAAATCTGG + Intronic
1126410024 15:48363802-48363824 CTGCCTAACTTGGAGAAGCCTGG + Intergenic
1126985376 15:54300792-54300814 TTTGTGACCTTGGACAAACCAGG - Intronic
1127749034 15:62014381-62014403 ATGCTGTCCTTGTAGAAACTTGG - Intronic
1128353232 15:66905948-66905970 CTCTTGACCCTGGAGGAACCTGG + Intergenic
1129692332 15:77720950-77720972 CTGCTGACCCAGGAGAGTCCCGG - Intronic
1130001410 15:80050526-80050548 CTGGTCACCATGGTGAAACCCGG + Intergenic
1130828625 15:87576639-87576661 CTTCTCACATTGGAGACACCTGG + Intergenic
1132951127 16:2563035-2563057 CTGCTGAGCTGGGAGAGACCGGG + Intronic
1132963223 16:2637135-2637157 CTGCTGAGCTGGGAGAGACCGGG - Intergenic
1134052342 16:11145716-11145738 CTCCTGACCTTGGCCAAGCCTGG + Intronic
1135908018 16:26531320-26531342 ATGCTGGCTTTGGAGAAATCAGG + Intergenic
1136066818 16:27765064-27765086 CTGCTGTACTGGGAGAAACTTGG - Intronic
1136136435 16:28259294-28259316 CTGCTGACCCTGGAGCGCCCTGG + Intergenic
1137684312 16:50375112-50375134 ATGGTCACCTTGGAGAAAGCTGG + Intergenic
1139665609 16:68453417-68453439 CTGGTGACCTTGGAGAGAGTGGG + Intergenic
1140111176 16:72006478-72006500 CTGCTGACCTTGAAGAAACTGGG - Intergenic
1140238337 16:73179081-73179103 CTACTGACCTTGTGGATACCTGG + Intergenic
1141357858 16:83365452-83365474 CAGCTGACCATGGGGTAACCAGG - Intronic
1141381355 16:83579926-83579948 GTGCTTACCTGGGAGACACCTGG + Intronic
1141386858 16:83629478-83629500 CTGAAGCCCTTGGAGAACCCTGG - Intronic
1141399606 16:83735765-83735787 CTGCTGACCAGGTAGATACCAGG + Intronic
1141797504 16:86285193-86285215 CTGCTGAGCTGCCAGAAACCTGG + Intergenic
1142017527 16:87758409-87758431 CTGATGAACTTGGACATACCAGG + Intronic
1144264556 17:13555488-13555510 CTGGGGACCTTGGAGAAGACAGG - Intronic
1146399404 17:32491650-32491672 CTGCTGGCCTGGGAGACCCCGGG - Intergenic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147822097 17:43247599-43247621 ATGATTACCTTGGGGAAACCAGG + Intergenic
1147895210 17:43746105-43746127 CTGCTGAGCTGGGAGGAAGCTGG + Intergenic
1154148654 18:11887952-11887974 CTGTTGACCTTGGACACAGCAGG - Intronic
1155204189 18:23543398-23543420 CTGCTGAGCCTGGAGAAAGAAGG - Intronic
1157250484 18:46091775-46091797 CTGTTGATCTTGAAGAAACTGGG - Exonic
1157585005 18:48795334-48795356 ATTGTGACCTTGGAGAAATCAGG - Intronic
1157772072 18:50358060-50358082 CTGGGGACCATGGTGAAACCAGG - Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161401213 19:4066888-4066910 CTCTTGCCCTCGGAGAAACCAGG - Exonic
1161615104 19:5265723-5265745 CTGCTGCCCTGGGAGACACTGGG + Intronic
1161926755 19:7306535-7306557 CTGCTGACTTAGAAGAAGCCAGG + Intergenic
1162457753 19:10796223-10796245 CTCCTGACCTTGTGGAAACGGGG + Intronic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
1166357169 19:42234020-42234042 CTGGAGACCTTGGGGGAACCGGG - Intronic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
1167812337 19:51845301-51845323 CTGATCAACATGGAGAAACCCGG + Intergenic
1168110349 19:54188746-54188768 CTCCTGTCCTTGGAGAACCCAGG + Intronic
1168594659 19:57665420-57665442 CTGCAGACACTGGAGATACCAGG - Intergenic
1168614303 19:57825476-57825498 CTGATCAACATGGAGAAACCTGG - Intronic
925915996 2:8606762-8606784 CTGCAGACCTTGGACCACCCGGG + Intergenic
928198241 2:29230005-29230027 CTGCTAACCTTTGAGATTCCAGG + Intronic
929665454 2:43830528-43830550 CTTCTGTCCTTGGAAGAACCTGG - Intronic
932955189 2:76343781-76343803 CTGGGGACCTCTGAGAAACCTGG - Intergenic
933698416 2:85237372-85237394 CTGCAGACCTCGGAGTCACCAGG - Intronic
934552125 2:95269003-95269025 CTGCTGATCTTGGAGAGAGAGGG + Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
936491232 2:112973870-112973892 CTAATGGCCTTGGAGAAACCTGG + Intronic
936754480 2:115689896-115689918 CTGCTGCCCTTGGACACCCCAGG - Exonic
938060131 2:128247700-128247722 CTGATCAACATGGAGAAACCCGG - Intronic
942209997 2:173660598-173660620 AGGCTGACATTGGGGAAACCTGG + Intergenic
942715416 2:178886147-178886169 CTGCTGACCTGGGAGAACCAGGG + Intronic
945579291 2:211572636-211572658 CTGCTAGGCTTGAAGAAACCAGG - Intronic
945664626 2:212725447-212725469 CTTCTGACATTCGAGAAAACAGG - Intergenic
947848446 2:233264442-233264464 TTGCTGACCAGGGAGAAGCCTGG + Intronic
948260919 2:236603952-236603974 CAGATGACCTTGGAGAAAGCAGG + Intergenic
948682680 2:239646591-239646613 CTTCTGACTATGGAGTAACCGGG - Intergenic
948773904 2:240270153-240270175 CTGCTGGACCTGGAGAGACCAGG - Intergenic
948886639 2:240888192-240888214 CTGCTGACCTGGGAGAGAATGGG + Intronic
1168790986 20:575526-575548 CTGCAGACCTTTGAGTGACCAGG - Intergenic
1168904771 20:1394283-1394305 CTTCTAACCTTGGCTAAACCTGG - Intergenic
1169805959 20:9559325-9559347 CTGCTGACCTTAGATTTACCTGG - Intronic
1171901534 20:30863091-30863113 CTGCTGGCTTTGGAGACTCCTGG - Intergenic
1173704195 20:45098131-45098153 TGGCTGACCATGGAGAACCCGGG - Exonic
1174156947 20:48521752-48521774 CCGCTGGCCTTGGACAGACCAGG + Intergenic
1174360272 20:50024470-50024492 CTGATGACCCTGGCTAAACCAGG + Intergenic
1175568277 20:59998275-59998297 CTGCTGAGCTTGGAGGAGACTGG + Intronic
1175967314 20:62666060-62666082 CCGCTGACCTTGGAGCACTCTGG + Intronic
1176738561 21:10575434-10575456 CTGCTGGCTTTGGAGAATACAGG + Intronic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1178367664 21:32000828-32000850 TGGCTGACCTTGGTGAGACCTGG + Exonic
1179655697 21:42842882-42842904 CTGCTGTCCCTGCAGAATCCTGG - Intergenic
1180013948 21:45070839-45070861 CTCCTGACGTTTGAGAAACAAGG + Intergenic
1181323828 22:22029671-22029693 CTGCTGGCCTGGGAGCATCCAGG + Intergenic
1181422473 22:22811433-22811455 CTGCGGGCCTTCTAGAAACCTGG - Intronic
1183083659 22:35473424-35473446 CAGCTCACCTAGCAGAAACCTGG + Intergenic
1183210730 22:36449730-36449752 CTGGAGAGATTGGAGAAACCCGG - Intergenic
1184734748 22:46391487-46391509 CTCTTGACCTTCTAGAAACCTGG - Intronic
1184785207 22:46668305-46668327 CAGCTGACCGCGGACAAACCGGG - Intronic
1184992479 22:48180259-48180281 GTGCTGACGCTGGAGAAACAGGG - Intergenic
1185205990 22:49539042-49539064 TTGCTGCCCTGGGAGAAAGCTGG - Intronic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
949308045 3:2665572-2665594 CTGGTCACTTGGGAGAAACCTGG + Intronic
949386699 3:3510764-3510786 CTGGGGACCTTGAAGAAACGCGG + Intergenic
949820352 3:8109587-8109609 CGGCTGACCCCGGTGAAACCCGG + Intergenic
950571772 3:13804819-13804841 CAGCTGACCTTTGAGCAACACGG + Intergenic
953158675 3:40398167-40398189 CTGCAGACCCTGGTGAAAGCTGG + Intronic
953687885 3:45092516-45092538 CTGGTAACCTTGGAGATATCAGG + Intronic
954273878 3:49529980-49530002 CTTCTGCCCTTGGAGAGACCAGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
955536402 3:59928346-59928368 CTGATGACATTGGGGCAACCTGG - Intronic
959251573 3:103954535-103954557 CTGCTGAGGTTGAGGAAACCTGG + Intergenic
962990475 3:140573071-140573093 CTGCTCAGCTTACAGAAACCTGG - Exonic
964747588 3:160026677-160026699 GATCTGACCTTGGAGAGACCAGG + Exonic
964878675 3:161399260-161399282 CATCTGACCTTCGAGAAACCTGG + Intergenic
968592542 4:1466174-1466196 CTGCTGCACTTGGAGCAAACTGG - Intergenic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
970151008 4:13090023-13090045 CTGCTGTCATGAGAGAAACCAGG - Intergenic
970163648 4:13214338-13214360 TTGCTGACCTTGGAGAGAGAGGG - Intergenic
970331002 4:14983647-14983669 CTGTTGACCTTATTGAAACCAGG - Intergenic
970445484 4:16120464-16120486 CTGCCAACCTTGGAGAATCGAGG - Intergenic
971987972 4:33851189-33851211 CTGATCAACGTGGAGAAACCCGG + Intergenic
972278637 4:37582775-37582797 ATCCTTACGTTGGAGAAACCCGG - Intronic
972504565 4:39708084-39708106 CTGACCACCATGGAGAAACCCGG - Intronic
972601298 4:40575359-40575381 CTGATCAACATGGAGAAACCCGG + Intronic
975223466 4:71841185-71841207 TTGCTAACATTGGAGAAAACTGG - Intergenic
975699392 4:77048472-77048494 CTGTTGTCCTTGGAGAAGTCTGG + Exonic
976983585 4:91264079-91264101 CTGCTGACTTTTAACAAACCAGG + Intronic
978079124 4:104570169-104570191 CTGCTGGACTTTGAAAAACCAGG + Intergenic
978852984 4:113360280-113360302 CTGGTGACCTTGGAGAAACGAGG - Intronic
979103312 4:116651006-116651028 CTGGTGACCTTGGTGAGAACAGG + Intergenic
980648369 4:135675795-135675817 TTGCTGACTATGGAGATACCAGG + Intergenic
982065920 4:151654370-151654392 CTGCTGACCATGCAGTGACCAGG - Intronic
982397193 4:154925461-154925483 CTGCTGGCTTTGGAGAATACAGG - Intergenic
982554870 4:156847671-156847693 ATGCTAACATTGGAGGAACCTGG + Intronic
983788483 4:171763779-171763801 CATCTGACCTTTGACAAACCTGG + Intergenic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
985022888 4:185710828-185710850 CTGATGAGCTTAGGGAAACCCGG + Intronic
986089982 5:4494509-4494531 CTGTTGACCTGGGAGAAGCACGG - Intergenic
988419744 5:30990980-30991002 CAGCTTACTTTGGAGAAACATGG + Intergenic
988590650 5:32546034-32546056 CTGCTCAACATGGTGAAACCCGG - Intronic
988817360 5:34847597-34847619 CTCCTTGACTTGGAGAAACCGGG - Intronic
991497570 5:67242552-67242574 TTGTTGACTTTGCAGAAACCGGG + Intergenic
991618663 5:68522506-68522528 CTGCTGACACTGGAAAAGCCAGG - Intergenic
992522013 5:77563693-77563715 CTGCAGACACTGGAGAAACATGG + Intronic
993843268 5:92907450-92907472 CTCCTTACCTTGGACAAATCTGG + Intergenic
996414939 5:123200364-123200386 CTGGTGAACATGGTGAAACCTGG - Intergenic
997232491 5:132254811-132254833 CTCCTGACCTTGGACAGACCTGG + Intronic
998178646 5:139919110-139919132 GTGCTGAGATTGCAGAAACCTGG - Intronic
1001058749 5:168470642-168470664 CTGATCAACATGGAGAAACCTGG + Intronic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1009548859 6:65059906-65059928 CTGGTGAAGTTGGAGAAACATGG + Intronic
1010232886 6:73551030-73551052 CTGCTCAACATGGTGAAACCCGG + Intergenic
1011003698 6:82620375-82620397 TTGCTGACCTTGGAGATGCAGGG + Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012878066 6:104753310-104753332 CTGCTGGCTTTGGAGAATACAGG + Intronic
1013102221 6:106996613-106996635 CTGATCAACATGGAGAAACCTGG - Intergenic
1013415462 6:109920733-109920755 ATGATGATCTTGGAGAAACAAGG - Intergenic
1013454762 6:110320473-110320495 CTGCTGGCCTTCTAGTAACCCGG + Intronic
1013638691 6:112052869-112052891 CTGGTGTCCTTGGAGAACCATGG - Intergenic
1015580326 6:134717342-134717364 CTGCTCAACATGGTGAAACCCGG - Intergenic
1017521280 6:155205501-155205523 CAGCAGACCCTGGAGACACCAGG - Intronic
1017522899 6:155217573-155217595 CTGCTTACCTTGTAGAAAATGGG - Intronic
1018540939 6:164878399-164878421 CAGCTGGCCTTAGAGAAGCCTGG + Intergenic
1019620725 7:1990647-1990669 CAGCTGTGCTTGGAGGAACCGGG + Intronic
1019877721 7:3829577-3829599 CTGCTTTCATTGGAGAAACGAGG - Intronic
1020288521 7:6705177-6705199 CTGCTGCTCTTGGAAAAATCTGG + Exonic
1021300581 7:18967970-18967992 CTGACCAACTTGGAGAAACCCGG + Intronic
1021823051 7:24517058-24517080 CTCTTGACCTTGGAGTAGCCTGG + Intergenic
1021944227 7:25709862-25709884 GTGTTGACATTGGAGAAAGCTGG - Intergenic
1022078354 7:26995820-26995842 CTGCTGAGCCTTTAGAAACCTGG - Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024798699 7:53050642-53050664 CTGCAGAACTTGGGGAAACTGGG + Intergenic
1024955977 7:54921253-54921275 CTGCTGATCTTGGAACCACCAGG + Intergenic
1026384148 7:69829100-69829122 CAGCTGATCTTGGACAAACTTGG + Intronic
1026385717 7:69845727-69845749 CTGCTGACCCTAGAGCAAGCTGG + Intronic
1026739041 7:72967006-72967028 CTGGTGACCTTGGGGACACAGGG - Intronic
1026790060 7:73325638-73325660 CTGGTGACCTTGGGGACACAGGG - Intronic
1027104692 7:75398067-75398089 CTGGTGACCTTGGGGACACAGGG + Intronic
1030692147 7:112547007-112547029 CTGCTGACTCTGAAGAATCCAGG - Intergenic
1030799859 7:113836345-113836367 GGGCTAACCCTGGAGAAACCTGG - Intergenic
1030904495 7:115165000-115165022 CTCTTGACCTTAGAGAAATCAGG - Intergenic
1031060422 7:117045380-117045402 CTGCTCTCCTTGGATACACCAGG + Intronic
1031994413 7:128219942-128219964 GAGCAGACCTTGGAGAAAACTGG - Intergenic
1032885654 7:136135676-136135698 CTGCTGACCCTTGAACAACCTGG + Intergenic
1035047096 7:155974670-155974692 CTGCTGATCTTGGAGAAGGAAGG + Intergenic
1035496017 7:159326815-159326837 CTGCTGACCTTGAAGGCAGCAGG - Intergenic
1036746746 8:11415304-11415326 CTGCTGAGCTGGGTGAAATCCGG + Intronic
1037818360 8:22123814-22123836 CTGCTGACCACGGAGAGAACAGG + Intronic
1038207953 8:25486610-25486632 CTGGTCAACTTGGTGAAACCTGG + Intronic
1038244039 8:25837661-25837683 CTGCTGACGTCAGAGAAAGCTGG + Intergenic
1038921923 8:32094161-32094183 GTGCTGAATTTGGAAAAACCCGG + Intronic
1039249732 8:35649588-35649610 AACCTGACCGTGGAGAAACCTGG + Intronic
1040786776 8:51176138-51176160 CTGCTGACCATGGAGATTTCTGG - Intergenic
1041187065 8:55311919-55311941 CTGCAGACCAAGGAGAAGCCAGG - Intronic
1043232840 8:77824158-77824180 CTGCTCAACATGGCGAAACCCGG + Intergenic
1045193233 8:99904144-99904166 CTGCTGACCTAGGGGAACGCTGG + Intergenic
1046749312 8:117910264-117910286 CTGCTGATGATGAAGAAACCGGG + Intronic
1047372191 8:124265309-124265331 TTGCTGGCCATGCAGAAACCCGG - Intergenic
1049749880 8:144278040-144278062 CTGGAGACCCTGGAGAATCCGGG - Intronic
1049882375 8:145075196-145075218 CTGCTGGCTCTGGAGAATCCCGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1052750801 9:32487926-32487948 CGTCTGACTTTGGAGATACCTGG + Exonic
1058966321 9:110042234-110042256 CTGATCAACATGGAGAAACCCGG + Intronic
1059077067 9:111204819-111204841 CATCTGACCTTAGAAAAACCTGG + Intergenic
1061280664 9:129596408-129596430 CTGGGGAGCTGGGAGAAACCAGG + Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062436501 9:136548722-136548744 CTGCTGACATTGGCCCAACCAGG + Intergenic
1185507795 X:642925-642947 CTGGTGACCTTGGAGAGGCTTGG + Intronic
1185507852 X:643115-643137 CTGGTGACCTTGGAGAGGCTTGG + Intronic
1185507940 X:643414-643436 CTGGTGACCTTGGAGAGGCCTGG + Intronic
1185507969 X:643496-643518 CTGGTGACCTTGGAGAGGCTTGG + Intronic
1186941274 X:14510313-14510335 CTGCTGAGCTGGGAGGAAGCTGG + Intergenic
1187179526 X:16930597-16930619 TTGCTGACCTTCCAGAAACAAGG + Intergenic
1187448531 X:19377656-19377678 CTGCTGACTTCCGGGAAACCAGG - Intronic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1192023483 X:67422678-67422700 CATCTGATCTTTGAGAAACCTGG - Intergenic
1196372144 X:114991188-114991210 CTGCTGATTTTGAAGAAACTTGG - Intergenic
1200406615 Y:2818364-2818386 CTGGCGAACTTGGTGAAACCCGG + Intergenic