ID: 954639190

View in Genome Browser
Species Human (GRCh38)
Location 3:52088016-52088038
Sequence CTGAAGAAATGGGTTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954639190 Original CRISPR CTGAAGAAATGGGTTGCAGA AGG (reversed) Intronic
901056666 1:6451514-6451536 CTTAGGAAAGGGGCTGCAGAGGG + Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902667792 1:17951796-17951818 CTGAAGGTAGGGGCTGCAGAGGG + Intergenic
902698089 1:18153851-18153873 CTGATGAAATGAGATGCAGCTGG - Intronic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
903452194 1:23461717-23461739 CAGAAGAAAGGGGTGACAGAGGG - Intronic
903889658 1:26561022-26561044 CTGAAGAAAGGGGGTGCATGTGG - Intronic
903901070 1:26645841-26645863 CTGATGAAATGTATTGCTGATGG + Intergenic
903993619 1:27290683-27290705 CTGAAGAAAGGAGTTAAAGAAGG - Intronic
904817991 1:33220010-33220032 CTGGAAAAATGGGTTTCTGATGG + Intergenic
906781770 1:48579149-48579171 TTGGAGAAAAGGGTTGGAGAGGG - Intronic
907907399 1:58795883-58795905 CTGGAGAAATGGGGGGCTGAGGG + Intergenic
908307046 1:62830468-62830490 CTGGTGGAATGGGTTGCAAATGG + Intronic
909810023 1:79922037-79922059 CTGAAGAATAGGGTTGCTTAAGG + Intergenic
910422631 1:87083305-87083327 CTGAAGTCATAGCTTGCAGATGG + Intronic
910711870 1:90190187-90190209 CTGAAGGAATGGGATGGAAAAGG - Intergenic
911194635 1:94981355-94981377 CTGGAGAAATGTGTAGCCGAAGG - Exonic
911368671 1:96971072-96971094 CTCAAGAAATGTTTGGCAGAGGG - Intergenic
911380844 1:97112230-97112252 CTGGAGAAATGGTTTGCTGAAGG - Intronic
913166410 1:116190994-116191016 GAGAAGAAAAGGGTTTCAGATGG + Intergenic
913230020 1:116734052-116734074 TGGAAGAGAGGGGTTGCAGAAGG - Intergenic
913518504 1:119624316-119624338 CTGAAGAACTGGTGGGCAGAGGG - Intronic
917293337 1:173493711-173493733 CTGATGAAACAGGTTGCAGTAGG + Intergenic
918159406 1:181883376-181883398 CTGCAGAAGTAGGTTTCAGAAGG + Intergenic
921149057 1:212385545-212385567 GAGAAGAAAAGGGTTTCAGAGGG + Intronic
921308743 1:213822188-213822210 ATGAAGAAAGGGCTTCCAGAAGG - Intergenic
922792889 1:228319906-228319928 CTGAAGAGATGGATGGCAGTTGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
1063006712 10:1978750-1978772 TTGAAGGGAGGGGTTGCAGAAGG - Intergenic
1064317466 10:14271491-14271513 CTGAAGAAACCCCTTGCAGACGG + Intronic
1064450874 10:15441032-15441054 CTGAAGAAGTGGCTTCCAGGGGG - Intergenic
1065370519 10:24980330-24980352 AAGAAGAAAAGGGTTGCAGAGGG - Intergenic
1065388096 10:25153705-25153727 CTGGAAAAGTGGGCTGCAGATGG - Intergenic
1067058591 10:43066288-43066310 CTGAAAAAACGGGTGTCAGAAGG + Intergenic
1067485535 10:46646379-46646401 TGTAAGAAATGGGTTGCAGGCGG - Intergenic
1067609223 10:47695273-47695295 TGTAAGAAATGGGTTGCAGGCGG + Intergenic
1068375171 10:56168772-56168794 CTGAAGTCATGGGATGTAGACGG - Intergenic
1068487724 10:57681087-57681109 CTGGAGAAATGTGTTGCTGCTGG - Intergenic
1069591130 10:69642650-69642672 CCCAAGAAATGGGGAGCAGAGGG - Intergenic
1069682152 10:70292770-70292792 CCCAAGAAATGGTTTACAGAAGG - Intergenic
1070261500 10:74860584-74860606 CCGAAGAAATGAGAGGCAGAAGG - Intronic
1070447828 10:76524999-76525021 CTGAGACAATTGGTTGCAGAAGG - Intronic
1070725177 10:78782776-78782798 CTTGAGAAATAGTTTGCAGAAGG - Intergenic
1071624810 10:87156919-87156941 TGTAAGAAATGGGTTGCAGGCGG + Intronic
1074021719 10:109591442-109591464 CTTAAGGAATGTTTTGCAGATGG - Intergenic
1074686309 10:115965302-115965324 CTGAGCAAATGGGTTGCAAATGG - Intergenic
1074808342 10:117076861-117076883 CTGGAGAAAAGGGTGGCAAATGG + Intronic
1075691073 10:124394565-124394587 CTGAAGAAAGGGGTTGAAGCAGG - Intergenic
1076464056 10:130666382-130666404 CTGCAGAGTTGGGGTGCAGAGGG + Intergenic
1077697392 11:4406682-4406704 TTGAAGAAAGGGGTGACAGACGG - Intergenic
1077711890 11:4545570-4545592 ATGACGTAGTGGGTTGCAGATGG - Exonic
1078285374 11:9948544-9948566 TTGAAGAAATGGCTAGCAGCAGG - Intronic
1079581905 11:22075660-22075682 GTGAAGACCTGGGTTGCAAAGGG - Intergenic
1081230774 11:40583351-40583373 GTTGAGAAATGGGCTGCAGAAGG + Intronic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1088241750 11:107780384-107780406 CTGAAGAAATTGGTGCCTGAGGG - Intergenic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1090057513 11:123436271-123436293 CTGGGGAAATGGGATGGAGAGGG - Intergenic
1090094172 11:123727329-123727351 CAGAAGAAATGGCTGTCAGAGGG + Intronic
1090355405 11:126137250-126137272 CAGAAGGAAAGGGTTGCAGTAGG - Intergenic
1093111961 12:15163423-15163445 GTGAAGAATTGGGTTACATAGGG + Intronic
1093973285 12:25394034-25394056 AAGAAGAAATGGTTTGCAAATGG - Intergenic
1096720190 12:53515619-53515641 TTGAAGAGTTGGGTTGCAGAGGG - Exonic
1096923516 12:55115915-55115937 ATGAAGAAGAGGATTGCAGATGG - Intergenic
1098842093 12:75488775-75488797 CTGAAGAAATGAGGTGGAGCTGG - Intronic
1099514680 12:83583381-83583403 CTCAGGAAATGGGATCCAGATGG - Intergenic
1100900148 12:99230166-99230188 CTGATGAAATGATTTGCACAAGG + Intronic
1101194325 12:102367345-102367367 ATGAAGAAATGTGTTGATGATGG - Intergenic
1101440207 12:104698241-104698263 CTGGAGAAATGGGTTGAGGTTGG - Intronic
1101647899 12:106648149-106648171 ATGAAGAAGTGGTTAGCAGATGG + Intronic
1102217312 12:111170641-111170663 CAGAAGAACTGGGTTTCAGGAGG - Intronic
1104905145 12:132209224-132209246 CTGATAAAATAGGTTGCAGTAGG + Intronic
1105326950 13:19379338-19379360 CTGATGAAATAGTTTGAAGATGG - Intergenic
1105783673 13:23726307-23726329 CTGAAGAAATGCTTGGCTGATGG - Intergenic
1105814626 13:24023538-24023560 AAGAAGAATTAGGTTGCAGATGG + Intronic
1106006780 13:25778015-25778037 CAGGTGAAATGAGTTGCAGAAGG - Intronic
1107258931 13:38467578-38467600 CTGAAGAAACGTGCTGGAGAAGG - Intergenic
1107382012 13:39866911-39866933 ATGAAGAAATAGTTTCCAGAAGG - Intergenic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1108052462 13:46459987-46460009 CTGAAGAAATGGGAGACAAAAGG - Intergenic
1108776482 13:53771635-53771657 CTGAAGCAATCGGTTGCCTATGG - Intergenic
1109034681 13:57241355-57241377 CTGAAGAAACTGTTTCCAGATGG + Intergenic
1109421404 13:62116566-62116588 CTGAAGAAAAGGGTTTAAAAAGG - Intergenic
1109538811 13:63746114-63746136 CTGAAGAAATGGGAGACAAAAGG + Intergenic
1109545024 13:63833650-63833672 CTGAAGAAATGGGAGACAAAAGG - Intergenic
1110110883 13:71744493-71744515 CTGAAGAATTGTGATGCAGTAGG + Intronic
1110415467 13:75247054-75247076 AAGAAGAAATGGGTGACAGATGG - Intergenic
1110461212 13:75747767-75747789 AGGAAGAATTAGGTTGCAGATGG + Intronic
1111624272 13:90763910-90763932 CAGAGGAAATGGATTACAGATGG + Intergenic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112920331 13:104604395-104604417 CGGAAGAACTGGGTTGCATGTGG - Intergenic
1116626377 14:47269907-47269929 CTGATGTAATGGGTTGCAAGGGG - Intronic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1117946177 14:61024398-61024420 CTGAGGAAATGGGCTGCAGAGGG - Intronic
1120454856 14:84718203-84718225 CTGAAGAGGTGAGTTGCAGAGGG - Intergenic
1121099802 14:91242601-91242623 ATGAGGGAATGGGTGGCAGATGG + Intronic
1121407888 14:93729888-93729910 CTGAAGAAATGGGGTTGAGAGGG + Intronic
1124032740 15:26026304-26026326 CTGATGAAACAGGTTGCAGTGGG - Intergenic
1124929307 15:34103624-34103646 CTGAAAAAAAGGATTGCAAAGGG + Exonic
1125368146 15:38941496-38941518 CTGAAGGATTAGGTTGCAGCTGG - Intergenic
1125456532 15:39865726-39865748 TTAAAGAAATTGGTGGCAGATGG - Intronic
1126480593 15:49115097-49115119 CTGAAGAAATTGGGTACAGAAGG + Intronic
1129058498 15:72839734-72839756 CAGAAGAGAGGGGTTGCAAATGG - Intergenic
1129615613 15:77097024-77097046 CTGAGCAAAGGGGTTGCAGGAGG - Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130859567 15:87874514-87874536 GAGAAGAACTGGGTTGGAGATGG - Intronic
1131277179 15:90991951-90991973 CAAAAGAAATGGCTTTCAGATGG - Intronic
1135334492 16:21589262-21589284 CTGAAAAGATGGGCTTCAGAGGG + Intergenic
1135336854 16:21608992-21609014 CTGAATAAATGGGAAGCATAGGG - Intronic
1135705401 16:24670678-24670700 CTGAAGAAATGAGATTCGGATGG + Intergenic
1137477360 16:48820923-48820945 CTGAAGCAATGGGAGTCAGATGG + Intergenic
1139970230 16:70769780-70769802 CTTAAGCCATGGGCTGCAGAGGG - Intronic
1140200213 16:72888792-72888814 CAGAGGAAATGGGTTGTAGGAGG + Intronic
1140326362 16:74006512-74006534 GTGAAGAAATGAGGCGCAGAAGG - Intergenic
1140877106 16:79162827-79162849 GGGAAGACATGGTTTGCAGAAGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1143012331 17:3872791-3872813 CTGAATGAATGAGTTGCTGAGGG + Intronic
1144186816 17:12804299-12804321 CTGGAGGGAGGGGTTGCAGAGGG + Intronic
1144650515 17:17004246-17004268 GTGGAGGAATGGGTTGAAGAGGG - Intergenic
1145951856 17:28824769-28824791 AAAAAGAAATGGGTTGTAGAAGG - Intronic
1148026978 17:44595246-44595268 GTGAGGAATTGGGCTGCAGAGGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1152800617 17:82329119-82329141 CTGAGGACCTGGCTTGCAGACGG + Intronic
1153945244 18:10012130-10012152 CTGAAGAAGGAGGTAGCAGATGG + Intergenic
1153984763 18:10342404-10342426 CTCAAGAAAAGGGTTTCAGCTGG - Intergenic
1154044185 18:10888900-10888922 CTGAAAAACTGGGTTGTTGAGGG - Intronic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1156725330 18:40119948-40119970 TTGAAGAAAGGGGTGACAGACGG - Intergenic
1157595210 18:48859970-48859992 CTGAAAAAGTGGGTCGGAGACGG + Exonic
1157720547 18:49920553-49920575 CTGCAGAACTTTGTTGCAGAGGG + Intronic
1158073975 18:53507359-53507381 CTTTAGAAATGGGTTGCTGATGG - Intronic
1158803229 18:60938053-60938075 TTGAAAAAATGGATGGCAGAAGG - Intergenic
1158835511 18:61327511-61327533 CTGAAGGGATGGGGTGCAGGTGG - Intergenic
1159934088 18:74347492-74347514 CAGCAGAAATAGGTTACAGAGGG - Intronic
1161814682 19:6492738-6492760 CTGATAAAATAGGTTGCAGTAGG + Intergenic
1163326157 19:16604634-16604656 CAGAGACAATGGGTTGCAGAAGG + Intronic
1164451903 19:28373473-28373495 CTGAATATATTTGTTGCAGATGG + Intergenic
1167119862 19:47510370-47510392 CTGGAGAAATAGGTGGCAGAGGG - Intronic
1167703036 19:51061854-51061876 CAGAAGAAAGAGGTTGGAGATGG - Intronic
925423858 2:3732839-3732861 CTGAAGAACTGGGTTGTCTATGG - Intronic
927107166 2:19837687-19837709 CTGAAGAAATGAGTTTGAGGAGG - Intergenic
928239314 2:29572795-29572817 CTGAAGGAATGGGTGGATGAGGG - Intronic
929969489 2:46561807-46561829 CTAAAAAAATGCGGTGCAGAGGG - Intronic
930223580 2:48769340-48769362 CTGAAGAAGTGTTTTCCAGAAGG - Intronic
933718933 2:85384366-85384388 CTGAGGAAATGCCTTGCACAGGG + Intronic
936355978 2:111749608-111749630 CTGATGAACTGAATTGCAGAGGG - Intergenic
939558343 2:143703918-143703940 ATGAGGAAATTGGTTGCAGAGGG - Intronic
940461574 2:153969905-153969927 CTGAAAAGATGGATTGCTGAAGG + Intronic
940736626 2:157460792-157460814 CTGAAGGACTTGGGTGCAGAGGG + Intronic
941108319 2:161388543-161388565 GTGGAGAACTGAGTTGCAGAAGG - Intronic
941563384 2:167077551-167077573 CTGCAGAGATGGGTGGAAGATGG + Intronic
942572332 2:177326940-177326962 CTCAAGAGAAGGGTTGGAGATGG + Intronic
942766452 2:179463285-179463307 GTGAAGAAAATGGGTGCAGATGG - Intronic
944299166 2:198102920-198102942 CTGAAGAAATGTGATGGTGATGG + Intronic
947112177 2:226730509-226730531 CTGATTAAATTGGTTGGAGATGG - Intergenic
947789481 2:232855903-232855925 CTGAAGCAGTGGTTTGCAGGGGG + Intronic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1169281484 20:4271002-4271024 TTGAAGAAATTGATTGCAGGTGG - Intergenic
1170243353 20:14194175-14194197 CTGAAGACATGGATCTCAGAAGG + Intronic
1172433707 20:34913676-34913698 ATGAAGAAAGGGGTTGCTCATGG - Intronic
1174330095 20:49811257-49811279 CTGAAGACAAGGTTTGCTGACGG - Intergenic
1174866042 20:54136590-54136612 GTGAAGAAATGGGTTCAAAAAGG - Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1178228782 21:30756039-30756061 CTGAAGAAATGGGAGACAAAAGG - Intergenic
1178852325 21:36223123-36223145 CTCTAGAAATAAGTTGCAGATGG + Intronic
1179835225 21:44027424-44027446 CTGAAAATATGGGTTCCAAAAGG - Intronic
1182551987 22:31105575-31105597 CTTCAGAAAGGGGTGGCAGATGG - Intronic
1183797281 22:40130160-40130182 GGGAAGAAATGGGTTGAGGAAGG + Intronic
1184320825 22:43741032-43741054 CTGAAGAATTGAGCTGCAGATGG + Intronic
1184538792 22:45106243-45106265 CTGAAGCAAGGGGTAGCAGTGGG + Intergenic
1184754717 22:46509315-46509337 ATGAGGAGATGGGGTGCAGAGGG + Intronic
1184913483 22:47551174-47551196 TTCAAGAAAGGGGTTTCAGATGG - Intergenic
1185003894 22:48263893-48263915 CTGGAGAATTGTGTTGCACAAGG + Intergenic
949495056 3:4623299-4623321 CTGAATAAAGGGGTTGAAGCAGG - Intronic
950419009 3:12885776-12885798 CTGAAGCAATGGGAGGCAAAAGG + Intergenic
950450612 3:13063068-13063090 CTCAGGAAATGGGATGCACAGGG + Intronic
951902133 3:27667161-27667183 CTCAAGAAAGGGGTGGAAGATGG + Intergenic
953749823 3:45600659-45600681 CTGCAGAGGTGGGGTGCAGAGGG + Intronic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
955100719 3:55846998-55847020 ATGAAGAAATGATTGGCAGATGG + Intronic
955510947 3:59679723-59679745 CAGAACAAATGGATTGCTGAAGG + Intergenic
955734183 3:62019049-62019071 CTGAAGAAACTGGTTACAGCTGG + Intronic
955975097 3:64472429-64472451 ATCAAAAAATGGGTTCCAGAGGG - Intergenic
956528424 3:70190090-70190112 GGGAAGAAATGGGTTGGGGAGGG - Intergenic
956764368 3:72472003-72472025 CTGAAAAACAGGGTTGCAGCTGG + Intergenic
956765932 3:72484530-72484552 TTAAAGCAAAGGGTTGCAGAAGG - Intergenic
956882106 3:73520982-73521004 GTGAAGGAATGTGTTGCACATGG + Intronic
959850139 3:111075869-111075891 CTGAAGATAGGGGTTGGAGAAGG + Intronic
961450725 3:127001216-127001238 GTGAAGAAACGGGTCACAGAAGG - Intronic
962106931 3:132399969-132399991 GTGAAGAAATGGGTGGCAGAAGG - Intergenic
962631692 3:137282857-137282879 CTGAAGAAATGAGTTGAAGAGGG + Intergenic
962713640 3:138108560-138108582 AGGGAGAAATGGGTTGCAGGTGG - Intronic
964477500 3:157110033-157110055 ATGAAGACCTGGGCTGCAGAGGG - Intergenic
964696861 3:159518118-159518140 AAGAAGAAATAAGTTGCAGACGG + Intronic
965020618 3:163225424-163225446 CAGCTGAAATGGGTTGCCGAGGG + Intergenic
965482196 3:169232568-169232590 AGGAAGAAATGAGTTGCAGAGGG + Intronic
965904858 3:173691223-173691245 TTGAAGAAATGGGCTAAAGAGGG - Intronic
966229389 3:177634681-177634703 TTGAAGAACTGGTTTGGAGATGG - Intergenic
967049260 3:185767189-185767211 CTGAAGAAACAGGCTGCAGGTGG - Intronic
970261519 4:14229956-14229978 CTGAGTAGATGGGTTTCAGAAGG - Intergenic
972049965 4:34718365-34718387 CTGAAAGAATGGTTGGCAGAAGG - Intergenic
972184978 4:36517758-36517780 CTGAAGAAATGAGTTGATTATGG + Intergenic
973645342 4:52945172-52945194 CTGATGAAAGGGGTTACATATGG + Intronic
976081620 4:81361226-81361248 ATGAGAAAATTGGTTGCAGATGG + Intergenic
977061637 4:92265494-92265516 CTGAATAAATGTAATGCAGATGG - Intergenic
977308011 4:95349611-95349633 CTGAAGTAATAGGTTGCATGTGG - Intronic
977741802 4:100493153-100493175 CTTACTAAATGGGTTGGAGATGG - Intronic
979324049 4:119358291-119358313 TTGAAGAAATAGGTTTAAGAAGG + Intergenic
979363780 4:119796136-119796158 GTCAGGAAATGAGTTGCAGATGG + Intergenic
979912890 4:126392377-126392399 CTGAAAAAATGGGCTATAGAAGG - Intergenic
980606565 4:135099019-135099041 GTTAAGCAATGGGTTGCATAAGG - Intergenic
981562167 4:146059735-146059757 GTGAAGGAATGGGCTGCTGAGGG - Intergenic
981637927 4:146901659-146901681 CCGAAGAAAGGGGTTCCAGAGGG - Intronic
982894065 4:160894341-160894363 ATGAAGTAATGGATTTCAGAGGG + Intergenic
985318967 4:188687804-188687826 CTGCAGCAAAGGGTGGCAGAGGG - Intergenic
985404894 4:189628247-189628269 ATGAAGAGATGGGATTCAGATGG + Intergenic
985755237 5:1710050-1710072 TCAAAGAAATGGGTTACAGACGG + Intergenic
986107693 5:4675762-4675784 CTATAGAAATGAGTTGAAGAAGG + Intergenic
986505958 5:8451598-8451620 CTGAAGAATGGGGCTGCTGAAGG - Intergenic
986832431 5:11595155-11595177 CTGCTGAAATGGATTGCAGGAGG + Intronic
988266278 5:28954189-28954211 CTTAAGAATTTGCTTGCAGAGGG - Intergenic
988631662 5:32937891-32937913 ATTAAGAAGTGGGTTTCAGATGG - Intergenic
989822975 5:45817859-45817881 CTTTAGAAATGAGTTGCATATGG + Intergenic
989941467 5:50156385-50156407 TCAAAGAAATGGGTGGCAGACGG + Intergenic
990794231 5:59521725-59521747 CTGTAGAGATGGGTTGGGGAGGG - Intronic
992320357 5:75607611-75607633 CTGAACATAAGGGTTGCACAGGG + Intergenic
992603840 5:78434763-78434785 CTGAAAAACTGTGATGCAGAAGG + Intronic
992654012 5:78890511-78890533 CTAAAGCAATGGGCTGCAGAAGG - Intronic
997338845 5:133126796-133126818 CTGAAGAAATGGGTCTCAGATGG - Intergenic
997731140 5:136177450-136177472 CAGAAGATATGGGGTTCAGAGGG - Exonic
998808057 5:145938020-145938042 CTGTAGACATGGTTTGCAGAAGG - Exonic
999126571 5:149250484-149250506 CCGAAGAAATGGGCTGCACAGGG + Exonic
1000518598 5:162271787-162271809 GTGAAGAAATGGCATGAAGAAGG + Intergenic
1000518769 5:162273935-162273957 GTGAAGAAATGGCTTGAAGAAGG - Intergenic
1000543796 5:162573698-162573720 CTGAAGGTATTGTTTGCAGATGG - Intergenic
1000974947 5:167754543-167754565 CAGAAGTAATTGGTTTCAGAAGG - Intronic
1002034092 5:176452632-176452654 CTAAAGAAATAGCTTGCACAAGG + Intronic
1003334915 6:5161572-5161594 CTGAAGAAAGCAGTTGCAAAGGG + Intronic
1003469879 6:6419632-6419654 CTGTATAAATGTGTTTCAGAAGG + Intergenic
1004999991 6:21230760-21230782 ATCAAGCAATGGGTTCCAGAAGG - Intronic
1007769894 6:44184036-44184058 CTGATGAAATGGGCTCCAGGTGG + Exonic
1007936436 6:45736869-45736891 CTGAGGAAATGGGTCACAGAGGG - Intergenic
1008316657 6:50050895-50050917 GTGAAGAATTTGGTTGTAGAAGG - Intergenic
1009030379 6:58049878-58049900 ATGAAGAAATGTGTTAAAGAAGG + Intergenic
1009205905 6:60801123-60801145 ATGAAGAAATGTGTTAAAGAAGG + Intergenic
1009318473 6:62254830-62254852 CTGAAGGAATGGATTACGGAGGG + Intronic
1010713649 6:79204411-79204433 CTGAAGCATTGTGTGGCAGAGGG - Intronic
1010910412 6:81548383-81548405 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1010911089 6:81557612-81557634 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1013478087 6:110528137-110528159 GTGAAAAGATGGTTTGCAGAAGG - Intergenic
1015456787 6:133435468-133435490 CTGGGGAAATGGGTTGGTGAGGG + Intronic
1016283608 6:142448179-142448201 GTGTCGAAAGGGGTTGCAGAGGG + Intergenic
1018725108 6:166606201-166606223 CAAAAGAAGTGGGGTGCAGATGG - Intronic
1020647744 7:10835760-10835782 CTGAACAAATGAGTGGCAGAGGG + Intergenic
1020811237 7:12852643-12852665 CTGAAGAGATGCTTTGTAGAAGG + Intergenic
1020827777 7:13053071-13053093 CTAAAGAAATAAGTTTCAGAAGG - Intergenic
1023275259 7:38512310-38512332 CTGCAGAAATGAGCTGCAGTTGG - Intronic
1024886014 7:54143618-54143640 CTAAGTAAATGGGTGGCAGATGG + Intergenic
1025028263 7:55535578-55535600 CTGAAGAAGTGTTTTCCAGATGG - Intronic
1030852689 7:114510397-114510419 CAGAGGAAATGGGTTGGAAAAGG + Intronic
1030886074 7:114939058-114939080 CTGAAGAAATGCTCTGAAGAGGG - Intronic
1031128523 7:117803797-117803819 TTGAAGAAATGGGTACCAAATGG + Intronic
1031347658 7:120689027-120689049 CTGAAGAACAGTGATGCAGAGGG - Intronic
1032656827 7:133939430-133939452 CTGAAGCAGTGGGCTTCAGAGGG + Intronic
1032894909 7:136239622-136239644 TTGTAGTAATGAGTTGCAGAGGG + Intergenic
1033303779 7:140209436-140209458 CTGGAGACATGGGTGGCTGATGG - Intergenic
1033843942 7:145409361-145409383 CTGAAGAAAGTGCCTGCAGAGGG + Intergenic
1034673414 7:152873768-152873790 CTGAAGAAATAGGTAGGAAAGGG + Intergenic
1035955068 8:4068171-4068193 CTTAGGAAAGGGGTGGCAGAAGG + Intronic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1037178090 8:15970859-15970881 CTGAAGAAAAAGGGTGGAGATGG + Intergenic
1037854847 8:22364298-22364320 CTTAAGACCTGGGGTGCAGAGGG + Intergenic
1038044364 8:23753750-23753772 TTGAAGGAATGGGTTCTAGATGG - Intergenic
1038556337 8:28520813-28520835 CTGAAGATATGGAATGCAGTAGG + Exonic
1039888386 8:41668541-41668563 CTGCAGGACTGGGATGCAGACGG - Exonic
1041011320 8:53546911-53546933 ATGAGGGAATGGGTTTCAGAAGG - Intergenic
1041271331 8:56112033-56112055 CTGATGCAATGGCTGGCAGAGGG - Intergenic
1042624965 8:70748152-70748174 GTGAAGAAGTGGGTTGCAGCGGG + Intronic
1043833796 8:85021781-85021803 CTATAGATTTGGGTTGCAGAGGG + Intergenic
1044623452 8:94213403-94213425 CTGCAGAAATGGGTTCTACATGG - Intronic
1044661163 8:94592528-94592550 CTGAAGAAAAATGTTGCAGGGGG - Intergenic
1050602422 9:7266367-7266389 CTGAAGGATTGGGTTGCAAGGGG - Intergenic
1051994963 9:23203793-23203815 CTGAATATATGGGTGGCACAGGG - Intergenic
1052332063 9:27280569-27280591 CTGAAACACTGGGTTGTAGAGGG - Intergenic
1053483406 9:38433286-38433308 CTGAAGCAATAGGTTGGTGAGGG + Intergenic
1056136114 9:83631059-83631081 CTGAAGATATGGGTCACAGCTGG + Intronic
1060441885 9:123647673-123647695 GTGAGGAACTGGGTTGCACAAGG - Intronic
1061373518 9:130211244-130211266 CAGGAGAAAGGGGTGGCAGAGGG - Intronic
1187319833 X:18229123-18229145 TTTAAGAAAGGGGTTGGAGAGGG - Intergenic
1187731914 X:22264112-22264134 ATGTGGAAATGGGTTTCAGAGGG - Intergenic
1187774660 X:22742892-22742914 CGGAAGAGGTGGGTTGCAGTGGG + Intergenic
1192237974 X:69307992-69308014 CTGAAGAAAGGGGATGCAGCCGG + Intergenic
1193038425 X:76978841-76978863 TCCAAGAAATGGGTGGCAGACGG + Intergenic
1193763433 X:85495037-85495059 CAGAACTAAAGGGTTGCAGAGGG + Intergenic
1199499535 X:148494835-148494857 CTGAAGGACTGGATTCCAGAGGG - Intergenic
1202604863 Y:26630264-26630286 CTGATGAAATAGTTTGAAGATGG + Intergenic