ID: 954641041

View in Genome Browser
Species Human (GRCh38)
Location 3:52098020-52098042
Sequence CACAGCAGAGTGCAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 595}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954641035_954641041 7 Left 954641035 3:52097990-52098012 CCCCCAGACTAAGGCAGTTCTGT 0: 1
1: 0
2: 2
3: 19
4: 153
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595
954641033_954641041 16 Left 954641033 3:52097981-52098003 CCACAGTGGCCCCCAGACTAAGG 0: 1
1: 0
2: 2
3: 14
4: 154
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595
954641036_954641041 6 Left 954641036 3:52097991-52098013 CCCCAGACTAAGGCAGTTCTGTC 0: 1
1: 0
2: 0
3: 20
4: 200
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595
954641032_954641041 20 Left 954641032 3:52097977-52097999 CCTACCACAGTGGCCCCCAGACT 0: 1
1: 0
2: 0
3: 33
4: 300
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595
954641037_954641041 5 Left 954641037 3:52097992-52098014 CCCAGACTAAGGCAGTTCTGTCA 0: 1
1: 0
2: 1
3: 38
4: 208
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595
954641038_954641041 4 Left 954641038 3:52097993-52098015 CCAGACTAAGGCAGTTCTGTCAG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG 0: 1
1: 0
2: 3
3: 52
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954641041 Original CRISPR CACAGCAGAGTGCAGTGGTG AGG Intronic
900120872 1:1048190-1048212 CACGGCTGGGGGCAGTGGTGGGG - Exonic
900243284 1:1626794-1626816 CACAGCAGGCTGCAGGTGTGGGG - Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
900977619 1:6026995-6027017 CTGAGCACAGGGCAGTGGTGGGG + Intronic
901233005 1:7651653-7651675 CACATCAGAATCCAGGGGTGGGG + Intronic
901514969 1:9739050-9739072 CACAGCAGAGTCCAGTGCAAGGG + Intronic
902832233 1:19023208-19023230 CAGGCCAAAGTGCAGTGGTGTGG - Intergenic
903615314 1:24649361-24649383 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
903778045 1:25805766-25805788 CCCAGCAGAGGGCTGTGGGGTGG + Intronic
904094429 1:27966274-27966296 CGCAGCAAAGCGCTGTGGTGAGG + Intronic
904098906 1:28005668-28005690 CAGACTGGAGTGCAGTGGTGTGG - Intronic
904371347 1:30049398-30049420 GGTAGCAGAGAGCAGTGGTGAGG + Intergenic
904374092 1:30068881-30068903 GGCAGCATAGTGCAGTGGTTAGG - Intergenic
904445701 1:30571587-30571609 CTCAGCAGAGTGCGGAGGTAGGG + Intergenic
904478736 1:30781279-30781301 CACAGTGGAGTGGAGTGGAGTGG + Intergenic
904935947 1:34129707-34129729 TGCAGTAGAGGGCAGTGGTGAGG - Intronic
904964205 1:34359102-34359124 GCCAGGTGAGTGCAGTGGTGTGG + Intergenic
905047049 1:35013326-35013348 GACAGCATAGTGTAGTGGTTAGG - Intronic
905107911 1:35574921-35574943 AATAGCAGAGGGCAGCGGTGAGG - Intronic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
905736070 1:40327040-40327062 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
906396142 1:45466603-45466625 CAGACTGGAGTGCAGTGGTGTGG - Intronic
906424090 1:45695207-45695229 CAGGCCAGAGTGTAGTGGTGTGG + Intronic
907758631 1:57336004-57336026 CACATCATAATGCAGTGATGAGG - Intronic
907770571 1:57459389-57459411 CAGAGCTGAGTGCAAAGGTGTGG - Intronic
909817648 1:80016515-80016537 CAGGCTAGAGTGCAGTGGTGTGG + Intergenic
909997457 1:82298177-82298199 CAAGGCAGGGTGCAGCGGTGTGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
910298671 1:85680159-85680181 CACGCTGGAGTGCAGTGGTGCGG - Intronic
911297447 1:96134725-96134747 GAGAGCAGACAGCAGTGGTGGGG - Intergenic
911453325 1:98093546-98093568 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
912412577 1:109488818-109488840 TACAGCAGAGTGGAGAGCTGGGG - Intronic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912457217 1:109806204-109806226 CAAAGCAGAGTGGAGTGCAGTGG + Intergenic
913256476 1:116958795-116958817 GGCAGCAGAGAACAGTGGTGAGG - Intronic
915201544 1:154233362-154233384 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
915475496 1:156150497-156150519 CACAGAAGAGTCCAGTTCTGGGG - Intronic
915526788 1:156480978-156481000 CCCAGCTGATGGCAGTGGTGCGG - Intronic
915534108 1:156524263-156524285 CACAGCAGAGTGGAGTGTTGGGG + Intergenic
915815697 1:158962698-158962720 CACAGCAGCGAGCATTGGAGAGG + Intronic
915902906 1:159858896-159858918 CACAGCAGACAGCAGTGCTAGGG + Exonic
916848319 1:168676324-168676346 CACAGCAGAGTTGGGGGGTGTGG - Intergenic
918038886 1:180900077-180900099 CCCAGCTGAGAGCAGTGGTCTGG + Intergenic
918888624 1:190233235-190233257 GACAGTGGAGTGCGGTGGTGTGG + Intronic
919147312 1:193651764-193651786 CACTTCAGTCTGCAGTGGTGGGG + Intergenic
919607997 1:199709950-199709972 CACAGAAGAGTGGAGAGGAGGGG + Intergenic
919734455 1:200937025-200937047 CAGAGCAGAGTGCAGTGGGACGG + Intergenic
919754559 1:201058702-201058724 CAGAGCAGAAAGTAGTGGTGGGG + Intronic
919852098 1:201679752-201679774 GAGAGCAGAGTGCAGTGGCCAGG - Intronic
919879845 1:201894406-201894428 CAGAGGAGACTGCAGTGGTTTGG - Intergenic
920437076 1:205953959-205953981 CTCAGAACAGTGAAGTGGTGGGG + Intergenic
920498305 1:206470769-206470791 CTCAGCCGGGTGCAGGGGTGTGG + Intronic
921374343 1:214458693-214458715 CACAGCAGAGTTTAGTGGCTAGG - Intronic
921552164 1:216550609-216550631 AACAGCACAGTTCAGAGGTGTGG - Intronic
922243506 1:223773017-223773039 AACAGAGGAGTGAAGTGGTGAGG + Intronic
923198371 1:231689374-231689396 CAGACTGGAGTGCAGTGGTGTGG + Intronic
924351210 1:243116162-243116184 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
924665155 1:246063682-246063704 CAGACTAGAGTGCAGTGGTATGG + Intronic
1062786645 10:270711-270733 CACAGTACAATGCAGTGGCGTGG + Intergenic
1062824941 10:560192-560214 CACAGCAGAGAGCAGTCCTCGGG + Intronic
1062964644 10:1598117-1598139 CAAGGCAGAGGGCAGAGGTGGGG + Intronic
1063141504 10:3260108-3260130 CTCAGCAGAATGCAGTGGAAGGG + Intergenic
1063170712 10:3507554-3507576 AAGAGCAGAGTGCAGTATTGTGG + Intergenic
1063251633 10:4280936-4280958 CACAGCAGAGCCAAGTGTTGGGG - Intergenic
1063368016 10:5502963-5502985 CACAGAAGAGGGAAGTGGGGGGG + Intergenic
1063525782 10:6783645-6783667 CACAGCAGAGAGCACTGGGAAGG - Intergenic
1063921732 10:10939907-10939929 CAGGCTAGAGTGCAGTGGTGCGG - Intergenic
1064046247 10:12018534-12018556 CAGGCTAGAGTGCAGTGGTGCGG - Intronic
1064308001 10:14186014-14186036 CACAGCAGTGGGCAGAAGTGCGG + Intronic
1064340257 10:14479181-14479203 CAGAGCAGAGTGGAGTGCAGTGG - Intergenic
1064532115 10:16321230-16321252 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1064543580 10:16429375-16429397 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1064758567 10:18594984-18595006 CCCAGCAGAGGGCAGTAGTTGGG - Intronic
1065905315 10:30245685-30245707 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1066119954 10:32276465-32276487 CAGGCCAGAGTGCAGTGGTGCGG - Intronic
1066375300 10:34852700-34852722 CCCAGCAAAGTTCACTGGTGTGG - Intergenic
1066401589 10:35081827-35081849 TACAGTAGATTGTAGTGGTGCGG - Intronic
1066710572 10:38229251-38229273 CAGGCCAGAGTTCAGTGGTGTGG + Intergenic
1066778372 10:38912014-38912036 CGAAGTAGAGTGCAGTGGAGTGG + Intergenic
1066778427 10:38912401-38912423 CAGAGTAGAGTGGAGTGGAGTGG + Intergenic
1067060339 10:43075109-43075131 CTCAGCAGAGGACAGTTGTGAGG - Intergenic
1067180714 10:43983770-43983792 CACAGCAAAGTTCCGTGCTGAGG + Intergenic
1068773733 10:60849943-60849965 AAGAGAAGAGTGCAGTGATGTGG - Intergenic
1069062034 10:63904274-63904296 GATGGAAGAGTGCAGTGGTGAGG + Intergenic
1070195012 10:74149332-74149354 CAGGGTGGAGTGCAGTGGTGAGG + Intronic
1070245638 10:74729050-74729072 ACCTGCTGAGTGCAGTGGTGCGG - Intergenic
1070392270 10:75981805-75981827 CAGGCCGGAGTGCAGTGGTGTGG - Intronic
1070835112 10:79443146-79443168 TACTGTATAGTGCAGTGGTGGGG - Intronic
1070856054 10:79608754-79608776 CACAGCTGAGTGGCCTGGTGTGG + Intergenic
1071948207 10:90672083-90672105 CACAGCACAGTAAAATGGTGGGG - Intergenic
1072281632 10:93870939-93870961 CCCAACAGAGTGCAGTGTTCAGG + Intergenic
1072685763 10:97535871-97535893 CAGATTAGAGTGCAGTAGTGCGG - Intronic
1073017802 10:100415800-100415822 CACACCAGAATGTGGTGGTGTGG + Intergenic
1073347390 10:102794196-102794218 CACAGCAAAGAACAGTGGTGTGG - Intronic
1073610450 10:104937907-104937929 CACAGCAGTGCACAGTGGTTTGG + Intronic
1074083453 10:110186582-110186604 CAGGCCAGAGTGCAGTGGCGCGG - Intergenic
1074125085 10:110522404-110522426 GACAGCAGAGTTCAGTAGTGAGG - Intergenic
1074402393 10:113152796-113152818 CTCAGCAGTGATCAGTGGTGTGG + Intronic
1075413191 10:122244175-122244197 CACATCAGGGAGCAGGGGTGGGG - Intronic
1075853227 10:125605289-125605311 CACAGCATAGTGCAGCAATGTGG + Intronic
1075853231 10:125605367-125605389 CACAGCATAGTGCAGCAATGTGG + Intronic
1075853235 10:125605445-125605467 CACAGCATAGTGCAGCAATGTGG + Intronic
1076391798 10:130109115-130109137 CACAAGAGAGGGCAGTGGGGTGG - Intergenic
1076572371 10:131441133-131441155 CACGGCAGAGTGCCTGGGTGAGG - Intergenic
1076787346 10:132757860-132757882 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787387 10:132758012-132758034 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787510 10:132758404-132758426 CACAACACAGTGCCGTGGTGTGG + Intronic
1076797446 10:132805137-132805159 CACAGCAGAGTGGGCTGGGGGGG - Intergenic
1077366428 11:2163126-2163148 CCCAGCAGCGTGTAGTGGGGTGG + Intergenic
1077387120 11:2275317-2275339 TACAGCAGAGGGCAGGGGAGAGG - Intergenic
1077493346 11:2872370-2872392 CAGGCCAGAGTGCAATGGTGTGG + Intergenic
1078016229 11:7617374-7617396 CAGAACAGAGTGCAGTGGCTTGG + Intronic
1078200203 11:9174653-9174675 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1079595836 11:22245241-22245263 CACAGCAGTGCTCTGTGGTGGGG + Intronic
1080580986 11:33643467-33643489 CACAGCACAGCTCAGGGGTGGGG + Intronic
1080622263 11:33996711-33996733 CAGAGCAAAGTGCAGAGGTGGGG - Intergenic
1081540691 11:44032626-44032648 CATAGCAGAGTGGACTGGAGTGG + Intergenic
1081794723 11:45811419-45811441 CCCAGAAGCGTGCTGTGGTGTGG + Exonic
1082005495 11:47416754-47416776 CACACTGGAGTGCAGTGGTGCGG + Intergenic
1083078324 11:60065081-60065103 CAGATGGGAGTGCAGTGGTGTGG + Intronic
1083241751 11:61393562-61393584 CTCAGCAAAGAGCAGTGATGTGG - Intronic
1083319591 11:61837752-61837774 GAGAGCAGAGGGCAGTGATGAGG - Intronic
1085348021 11:75780650-75780672 CAAAGCAGGGGGCAGTGGTGGGG - Intronic
1085589382 11:77744071-77744093 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1085650226 11:78261241-78261263 CAGGCCGGAGTGCAGTGGTGTGG - Intronic
1086873728 11:92070468-92070490 CAGAGCAGAGTCCAGGGCTGGGG - Intergenic
1086900146 11:92358130-92358152 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1088695277 11:112361102-112361124 CACACCAGTCTGCACTGGTGGGG + Intergenic
1088767518 11:112998019-112998041 CTCAGCAGAGGGCAGAGCTGGGG + Intronic
1089082298 11:115787059-115787081 CACAGCAGATGGGGGTGGTGAGG + Intergenic
1089589919 11:119533586-119533608 GACAGAAGGGTGCAGGGGTGAGG - Intergenic
1090070870 11:123543883-123543905 CACAACAGAGTTCAGTAGTTAGG + Intronic
1090111124 11:123910663-123910685 CACTTCAGTCTGCAGTGGTGAGG - Intergenic
1090150030 11:124374328-124374350 ACCACCAGAATGCAGTGGTGGGG - Intergenic
1090394148 11:126407871-126407893 CACAGAAGAGGGCAGAGGAGTGG - Intronic
1091402025 12:186924-186946 GACAGCAGAGGGCAGTGGTTGGG - Intergenic
1091614173 12:2036423-2036445 CCCAGCAGAGGGCAGTTGTATGG + Intronic
1092770087 12:11888745-11888767 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1094695143 12:32810533-32810555 ACCAGCAGTGTGCAGAGGTGTGG - Intronic
1095439246 12:42226617-42226639 CAGGGTGGAGTGCAGTGGTGTGG - Intronic
1096185797 12:49579730-49579752 GGCAGCAGAGTGCAGGGGAGTGG - Intronic
1096190832 12:49617497-49617519 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1096228291 12:49883126-49883148 TACAGCAGAGGGGAGTGGGGAGG + Intronic
1096251156 12:50033309-50033331 CAGCGCAGAGTGCGGAGGTGGGG + Intergenic
1096443233 12:51664250-51664272 CAGACAGGAGTGCAGTGGTGCGG + Intronic
1096879458 12:54655723-54655745 CACCCAGGAGTGCAGTGGTGTGG + Intergenic
1096882061 12:54681154-54681176 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1097175380 12:57139388-57139410 CAGGGCAGAGTGTAGGGGTGAGG - Intronic
1097254427 12:57662431-57662453 CTCACTGGAGTGCAGTGGTGTGG + Intergenic
1097697867 12:62791882-62791904 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1097794622 12:63848048-63848070 CAGGCCAGAGTGCAGTGGCGTGG + Intronic
1098366038 12:69704114-69704136 CACAGCAGAATACACTGGTTTGG + Intergenic
1099993533 12:89752567-89752589 CAGAGCTGTGAGCAGTGGTGAGG - Intergenic
1100006798 12:89904462-89904484 GACTGTGGAGTGCAGTGGTGTGG + Intergenic
1100228908 12:92587312-92587334 CAGGCTAGAGTGCAGTGGTGCGG - Intergenic
1100784315 12:98063057-98063079 CACTGCAGAGGGCAGTGCTCTGG - Intergenic
1100822140 12:98441439-98441461 CAGGCCAGAGTGCAATGGTGCGG - Intergenic
1100826540 12:98479828-98479850 CACAGCAGACAGCAGTGGAGGGG + Intergenic
1102449435 12:113029754-113029776 CAGGCTAGAGTGCAGTGGTGTGG + Intergenic
1102560399 12:113758010-113758032 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1102697655 12:114812736-114812758 CAGATTGGAGTGCAGTGGTGTGG - Intergenic
1103160443 12:118724866-118724888 CCCAGCAGAATTGAGTGGTGGGG + Intergenic
1104149847 12:126071716-126071738 CACAGCAAATTGCAGATGTGAGG - Intergenic
1104896626 12:132168055-132168077 CACAGCTGAGTGTAGGGGTCGGG + Intergenic
1105392980 13:19999123-19999145 CACAGCACAGTACTGAGGTGTGG - Intronic
1105703879 13:22956749-22956771 CACAGGACAGGGGAGTGGTGAGG - Intergenic
1105856829 13:24381833-24381855 CACAGGACAGGGGAGTGGTGAGG - Intergenic
1106389598 13:29322378-29322400 TTCAGCAGAGTGCAGTGGCTGGG + Intronic
1107834578 13:44403306-44403328 CACAGCAAACAGCAGTGCTGCGG - Intergenic
1108635236 13:52327279-52327301 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1108652573 13:52495950-52495972 CACGCTGGAGTGCAGTGGTGTGG + Intergenic
1110666446 13:78123049-78123071 TACTGCAGAGGGCAGTGGTAAGG - Intergenic
1111983099 13:95037908-95037930 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1113160155 13:107370856-107370878 AAGTGCAGAGTGAAGTGGTGGGG + Intronic
1113260288 13:108553982-108554004 ACCATCAGAGTGCATTGGTGAGG - Intergenic
1113358974 13:109610707-109610729 GCCAGCAGAGGGCAGAGGTGGGG + Intergenic
1113924422 13:113932907-113932929 CACACTGGAGTGCAGTGGCGTGG + Intergenic
1113996994 14:16096963-16096985 TAGAGTAGAGTGGAGTGGTGTGG - Intergenic
1113997319 14:16099099-16099121 CAGAGGTGAGTGCAGTGGAGTGG - Intergenic
1114466498 14:22926718-22926740 CACAGAGGAGTACAGTGGGGAGG - Exonic
1114475674 14:22992922-22992944 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1115349532 14:32378961-32378983 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
1115397751 14:32928546-32928568 CAGCCTAGAGTGCAGTGGTGTGG + Intergenic
1116181563 14:41542752-41542774 CACAGCAGTGTTCTGGGGTGGGG + Intergenic
1116566338 14:46449011-46449033 CCCACCTGAGTGCAGGGGTGAGG + Intergenic
1117476161 14:56097022-56097044 CACAGGAGAGAGAAGTGGAGAGG + Intergenic
1119000096 14:70873831-70873853 CACAGCAGAGTCTAGGGTTGAGG - Intergenic
1119304123 14:73593381-73593403 CACGCTGGAGTGCAGTGGTGTGG + Intronic
1119501979 14:75137053-75137075 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1120332808 14:83115277-83115299 CACAAAAGATTTCAGTGGTGGGG - Intergenic
1121263343 14:92582490-92582512 CAGGCCGGAGTGCAGTGGTGTGG + Intronic
1121564839 14:94901532-94901554 CAAGGCAGAGTACAGTGTTGGGG - Intergenic
1121638555 14:95470141-95470163 CTCAGCAGCGAGCAGTGATGGGG + Intronic
1121661715 14:95640109-95640131 CCCTGCAGAGTGCTGGGGTGGGG - Intergenic
1122847926 14:104510864-104510886 CAGGTCAGAGTGCAGGGGTGGGG + Intronic
1123721338 15:23064331-23064353 CACTGGTGATTGCAGTGGTGTGG - Intergenic
1124364541 15:29062765-29062787 GAAAGCAGAGTGCGGTGGTTAGG + Intronic
1124436813 15:29657090-29657112 CACGCCAGAGGGCAGTGGCGCGG + Intergenic
1124476540 15:30039750-30039772 CAGGGTGGAGTGCAGTGGTGTGG + Intergenic
1124614492 15:31231593-31231615 GACAGCAGAAGGCAGGGGTGGGG + Intergenic
1124718587 15:32091753-32091775 CATAGCAGAGTGCAGGAGTATGG - Intronic
1124853987 15:33369229-33369251 GACAACAGAGTGCAGTGGCTAGG - Intronic
1126614934 15:50568032-50568054 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1126901464 15:53318895-53318917 GGCAGCAGAGTGGAGAGGTGTGG + Intergenic
1127483202 15:59396067-59396089 CACATCAGAGGGCAGTAGGGAGG + Intronic
1127919870 15:63485577-63485599 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1128188518 15:65666732-65666754 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1128414729 15:67434826-67434848 CAGGCCAGAGTGCAGTGGCGTGG + Intronic
1128459670 15:67857078-67857100 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1128532812 15:68466096-68466118 CACAGCAGAGTTGAGAGCTGTGG + Intergenic
1129029298 15:72606951-72606973 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1129244617 15:74271830-74271852 CAGAGCAGAGGGCAGAGGAGGGG + Intronic
1129365642 15:75052299-75052321 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1129434635 15:75528738-75528760 CCCAGCAGACTGCAGTGCAGTGG + Intronic
1129497175 15:75995141-75995163 CATACTGGAGTGCAGTGGTGCGG - Intronic
1129598492 15:76983225-76983247 CAGAGCAGAGCAGAGTGGTGGGG + Intergenic
1129678042 15:77642995-77643017 CAGAGCTAAGTCCAGTGGTGTGG - Intronic
1129895173 15:79099916-79099938 CACAGCAGAGTGGAGAAGAGTGG - Intergenic
1130553438 15:84906358-84906380 CCAGGCTGAGTGCAGTGGTGTGG + Intronic
1130871279 15:87974153-87974175 CACAGCCCAGTGCTGTGCTGCGG + Intronic
1131324225 15:91426956-91426978 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1132074474 15:98808722-98808744 TACACTGGAGTGCAGTGGTGCGG + Intronic
1132213916 15:100048749-100048771 CACAGCATAGAGCAGTACTGTGG + Intronic
1132367273 15:101266698-101266720 CCAAGCTGAGTGCAGTGGCGCGG - Intergenic
1132404378 15:101533485-101533507 CAGGGCAGGGAGCAGTGGTGGGG - Intergenic
1132625817 16:891022-891044 CACAGCAGAGAGCTCTGGTGAGG + Intronic
1132652939 16:1029644-1029666 CACAGCCTAGTGCGGAGGTGGGG + Intergenic
1132738973 16:1401532-1401554 CGCAGCTGAGGGCGGTGGTGGGG - Intronic
1132796304 16:1724998-1725020 CTCAGCAGTGTGAAGAGGTGGGG - Intronic
1133264385 16:4574773-4574795 CACTGCAGCGGGAAGTGGTGAGG + Exonic
1133316586 16:4888351-4888373 CACTGCAGGGTGCAGCTGTGAGG - Intronic
1134305436 16:13027880-13027902 CAGGCCAGAGTGCAGTGGCGTGG - Intronic
1134443523 16:14313573-14313595 CACAGCATAGGGATGTGGTGAGG + Intergenic
1134660766 16:15982759-15982781 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1134685224 16:16153857-16153879 CAGGCTAGAGTGCAGTGGTGAGG - Intronic
1135059104 16:19255743-19255765 TACAGTGGAGTGCAGTGGCGTGG - Intronic
1135086193 16:19476300-19476322 CAAACTGGAGTGCAGTGGTGTGG - Intronic
1136048782 16:27636107-27636129 CAGGCTAGAGTGCAGTGGTGCGG - Intronic
1136303391 16:29352078-29352100 CACAGCAGAGGGCATTCGCGTGG - Intergenic
1136466322 16:30446384-30446406 CAGACTAGAGTGCAGTGGCGCGG - Intergenic
1136467819 16:30457203-30457225 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1137027238 16:35489132-35489154 CACAGCAGATAGCAGGGGCGAGG + Intergenic
1137486264 16:48894091-48894113 GAAAGCAGAGTGAAGTGATGGGG - Intergenic
1137606909 16:49793163-49793185 GACAGAAGAGTGCAGCTGTGGGG - Intronic
1138059800 16:53878256-53878278 CAGACCAGAGTACAGTGGCGTGG - Intronic
1138063310 16:53913932-53913954 CAAGCCGGAGTGCAGTGGTGTGG - Intronic
1138370657 16:56524042-56524064 GGCAGGAGAGTGCAGTGGTGAGG - Intergenic
1138511093 16:57508798-57508820 CAGAGTAGAGTGTGGTGGTGAGG + Intergenic
1139206812 16:65037063-65037085 CAGAGCAGGCTGCAGTGATGTGG - Intronic
1139353364 16:66351749-66351771 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1139629510 16:68220414-68220436 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1139686490 16:68607896-68607918 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1139958017 16:70702422-70702444 CACCACAGAGAGCAGTGCTGAGG + Intronic
1140221283 16:73046433-73046455 GACACGAGAGTGCTGTGGTGGGG - Intronic
1141533806 16:84664979-84665001 CAGGTTAGAGTGCAGTGGTGTGG - Intronic
1141842585 16:86583645-86583667 CACTGGAGCGGGCAGTGGTGGGG + Intergenic
1142067030 16:88068587-88068609 CACAGAAGAGCCCACTGGTGCGG + Intronic
1142290537 16:89192029-89192051 CACGGGAGGATGCAGTGGTGGGG - Intronic
1142550438 17:735065-735087 CAGACTGGAGTGCAGTGGTGAGG + Intronic
1142983198 17:3683173-3683195 CACAGCACAGGGCAGGGTTGGGG + Intronic
1143413610 17:6728599-6728621 CACTTCAGCCTGCAGTGGTGAGG - Intergenic
1143755170 17:9061746-9061768 CAGACCAGAGTCCAGTGGCGTGG + Intronic
1145978886 17:28999817-28999839 CAGAGCAGAGTGATGTGGGGTGG - Intronic
1146203249 17:30879296-30879318 CACAGCACTAGGCAGTGGTGGGG + Intronic
1146223772 17:31048799-31048821 CTCAGGAGAATGCAGAGGTGGGG + Intergenic
1146468186 17:33103801-33103823 CACAGCTGAGGGCATGGGTGAGG - Intronic
1147364710 17:39952486-39952508 CACAGCAGGGTCTTGTGGTGAGG - Intergenic
1147450898 17:40503137-40503159 CACGGCAAAGGGCAGTGATGTGG - Intergenic
1147623753 17:41885827-41885849 GGCAGCAGAGTACAGTGGTTAGG - Intronic
1147642634 17:42013639-42013661 CATAGCAGAGGGCAGTGATAGGG - Intronic
1147701156 17:42396023-42396045 CAGGCAAGAGTGCAGTGGTGTGG + Intergenic
1147908290 17:43837853-43837875 CAGACTTGAGTGCAGTGGTGTGG - Intergenic
1147935465 17:44008099-44008121 CAGAGCAGGGTGTAGGGGTGAGG - Intronic
1148282407 17:46358945-46358967 CAGACTAGAGTGCAGTGGCGTGG - Intronic
1148304625 17:46576870-46576892 CAGACTAGAGTGCAGTGGCGTGG - Intronic
1148336551 17:46845833-46845855 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1148548407 17:48534074-48534096 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1148661986 17:49341617-49341639 CAGGCCAGAGTGTAGTGGTGTGG - Intronic
1148818567 17:50347184-50347206 CACAGCTTAGGGCTGTGGTGTGG - Intronic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1149484491 17:57031513-57031535 GAGAACAGAGTGCAGTGGTATGG + Intergenic
1149910889 17:60565901-60565923 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
1150031042 17:61735754-61735776 CAGGCTAGAGTGCAGTGGTGCGG - Intronic
1150795482 17:68233462-68233484 CAGGTTAGAGTGCAGTGGTGCGG - Intergenic
1150862762 17:68818145-68818167 CTAAGCAGAGTGGAGTGGAGAGG - Intergenic
1151594351 17:75067987-75068009 CACAGCAGTGTTCTGTGGTTTGG + Intergenic
1151615446 17:75207226-75207248 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
1151675683 17:75596238-75596260 TGCAGCAGAGGGCAGGGGTGTGG + Intergenic
1151973578 17:77471534-77471556 CACAGCAGAGCTCAGCAGTGAGG - Intronic
1151989329 17:77564219-77564241 CAGAGCATAGGGCAGGGGTGGGG - Intergenic
1152123589 17:78433388-78433410 CACAGCAGAGGGCACAGGTTTGG - Intronic
1152206039 17:78974827-78974849 CACAGCAGATGGCAGGGCTGGGG + Intronic
1152514976 17:80817762-80817784 CCCAGCAGAGGGTGGTGGTGGGG + Intronic
1203213980 17_KI270730v1_random:105759-105781 CAGAGTAGAGTGGAGTGGAGTGG + Intergenic
1154027450 18:10722273-10722295 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
1154300016 18:13184622-13184644 CCCTGCAGAGTGCTGTGGTGTGG + Intergenic
1154315459 18:13300335-13300357 CAGAACAGATGGCAGTGGTGAGG + Intronic
1154470919 18:14700309-14700331 CTAGGCAGAGTGCAGTGGTGAGG + Intergenic
1155952827 18:31932005-31932027 CACAGCATCGTGCACTGGTGTGG - Intronic
1156146657 18:34189382-34189404 CACGGCAGTGTTCAGAGGTGGGG - Intronic
1156487854 18:37477935-37477957 CTGAGCAGAGGGCAGGGGTGGGG + Intronic
1156569591 18:38238312-38238334 CACAGAAGAGGGCAGTGTTATGG + Intergenic
1157462420 18:47911304-47911326 CAGACTAGAGTGCAGTGGCGTGG - Intronic
1157503034 18:48204075-48204097 CACTGCAGAGAGAAGGGGTGAGG - Intronic
1157582316 18:48780834-48780856 CAGGGCAGAGTGCAGGGGTAGGG + Intronic
1158472262 18:57747406-57747428 CAGACTGGAGTGCAGTGGTGGGG - Intronic
1158949149 18:62475646-62475668 CACATTAGTCTGCAGTGGTGAGG + Intergenic
1158999375 18:62957664-62957686 CAGGCCAGAATGCAGTGGTGTGG + Intronic
1159043461 18:63346345-63346367 CACAGCAGAGGGCAAGGCTGGGG - Intronic
1159264917 18:66068541-66068563 CAGACCAGAGTGAAGTGATGTGG + Intergenic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1160234800 18:77077554-77077576 CACAGCATAGCCCTGTGGTGGGG + Intronic
1160239092 18:77110255-77110277 AAGAGAAGTGTGCAGTGGTGAGG + Intronic
1160258478 18:77267353-77267375 CACAGCTGAATGCAAAGGTGGGG - Intronic
1160534784 18:79586034-79586056 GAGTGCAGGGTGCAGTGGTGTGG - Intergenic
1160670110 19:358094-358116 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1161332877 19:3696691-3696713 TACAGCAGAGTGCAGACGGGAGG + Intronic
1161385197 19:3988056-3988078 CACGCTGGAGTGCAGTGGTGCGG + Intergenic
1161515693 19:4695104-4695126 CAGACTAGAGTGCAGTGGTGTGG - Intronic
1162139313 19:8576483-8576505 CACAGCAGAGAGCTGTGGGGTGG + Intronic
1162210192 19:9085157-9085179 CAGGGTAGAGTGCAGTGGTCTGG - Intergenic
1162379429 19:10322939-10322961 CACAGCAGCCTGCAGTGAGGTGG - Intronic
1162489020 19:10980794-10980816 CAGGCTAGAGTGCAGTGGTGCGG + Exonic
1162504800 19:11077073-11077095 CAGTATAGAGTGCAGTGGTGCGG + Intergenic
1163955999 19:20641089-20641111 CACGCTAGAGTGCAGTGGTGTGG - Intronic
1164596627 19:29534378-29534400 CACAGCAGAGTGGAGAAGGGTGG + Intronic
1164936636 19:32220022-32220044 CGGTGCAGAGTGCAGGGGTGTGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165223961 19:34341028-34341050 CAAAGCAGAGGGAGGTGGTGGGG - Intronic
1165387168 19:35517342-35517364 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1165531332 19:36404398-36404420 AACAGGAGTGTGGAGTGGTGGGG - Intronic
1165734262 19:38165804-38165826 CAGGCCGGAGTGCAGTGGTGCGG + Intronic
1166093254 19:40523688-40523710 CCCAGCATAGGGGAGTGGTGTGG + Intronic
1166251699 19:41575941-41575963 CACAGCAGAGGTCAGTACTGGGG + Intronic
1166276091 19:41755295-41755317 CACAGCAGAGGTCCGTGCTGGGG + Intronic
1166291194 19:41864624-41864646 CACAGTAGAGTGGAGAGGGGTGG + Intronic
1166412080 19:42562031-42562053 CACAGCAGAGATCAGTGCTGGGG - Intergenic
1167125225 19:47544705-47544727 CACAGCAGGAGCCAGTGGTGGGG + Exonic
1168020115 19:53603094-53603116 CAGACTACAGTGCAGTGGTGTGG + Intronic
1168221507 19:54963923-54963945 CAGGGTGGAGTGCAGTGGTGCGG + Intronic
1168395157 19:56041156-56041178 CAAAGCAGAAGGCAGTGGGGAGG + Intronic
927545582 2:23949828-23949850 CAGGCTAGAGTGCAGTGGTGAGG - Intronic
928286270 2:29992586-29992608 GACAGCTGGGTGCAGAGGTGGGG - Intergenic
928306865 2:30177532-30177554 CACAGCAGAGAGCAGTCAAGAGG - Intergenic
928521494 2:32093435-32093457 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
928975000 2:37077351-37077373 CACGCTGGAGTGCAGTGGTGTGG + Intronic
929473659 2:42222516-42222538 CACAGCAGAGTCCAGTAATTGGG + Intronic
929560979 2:42956297-42956319 CACACTGGAGTGCAGTGGCGTGG - Intergenic
930226645 2:48800893-48800915 AAAAGCTAAGTGCAGTGGTGAGG + Intergenic
930521521 2:52473382-52473404 CACTCCAAAGTGCAGTGCTGTGG + Intergenic
931443701 2:62309199-62309221 CACCTCAGAGGGCAGTTGTGAGG - Intergenic
932003048 2:67902171-67902193 CATAGCAGAGGGCAGAGGTGAGG - Intergenic
932060562 2:68494061-68494083 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
932199400 2:69812341-69812363 CACAGGAGAGTGGGGTGGTGGGG + Intronic
932488518 2:72103585-72103607 CTCAGCAGAGGGTAGGGGTGAGG - Intergenic
932491003 2:72120348-72120370 CAAGGTGGAGTGCAGTGGTGTGG - Intergenic
934100570 2:88649366-88649388 CAGGGTGGAGTGCAGTGGTGTGG - Intergenic
934169011 2:89323804-89323826 CAGGCCTGAGTGCAGTGGTGTGG + Intergenic
934198282 2:89858780-89858802 CAGGCCTGAGTGCAGTGGTGTGG - Intergenic
934752155 2:96800218-96800240 CACAGGAGAGGGCACTGGGGCGG - Intronic
935088062 2:99867725-99867747 GAAAGCAGAGTGGAGTGGAGGGG + Intronic
937147875 2:119662999-119663021 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
937694154 2:124789098-124789120 CACAGTGCAGTGCAGTGGAGTGG - Intronic
938003815 2:127770644-127770666 CAGGCCAGAGTGCAGTGGTGTGG - Intronic
938224339 2:129602808-129602830 CACAGCCAAGGGAAGTGGTGAGG - Intergenic
940112220 2:150167407-150167429 CAGGCTAGAGTGCAGTGGTGCGG - Intergenic
940553192 2:155187627-155187649 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
941928423 2:170917830-170917852 CTCAGCAGAGAGCAGATGTGAGG + Intergenic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
942577100 2:177375290-177375312 GACAGAAGAGTGCAGGGGTAGGG + Intronic
944805202 2:203274228-203274250 CAGACTGGAGTGCAGTGGTGCGG + Intronic
945265149 2:207883310-207883332 AACATCAGAGTCCAATGGTGAGG + Intronic
945575578 2:211525062-211525084 CACTTCAGCTTGCAGTGGTGAGG - Intronic
945929456 2:215840549-215840571 CAGGCTAGAGTGCAGTGGTGTGG + Intergenic
946003801 2:216505866-216505888 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
946184652 2:217973319-217973341 CAGGGCAGAGTGCAGTGGTGTGG - Intronic
946877612 2:224145826-224145848 CACAGCAGGTTGCAATGCTGTGG - Intergenic
947207362 2:227674088-227674110 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
948360965 2:237419975-237419997 CAAAGCAGAGAGAAGTGGAGAGG + Intergenic
948403985 2:237703820-237703842 CACAGCACAGTGCATTCCTGTGG + Intronic
948850340 2:240702540-240702562 GACGGGAGAGTGCAGTGGGGAGG - Intergenic
949054032 2:241914926-241914948 CACAGCAGTGAGCAGTCCTGGGG + Intergenic
1169151919 20:3296222-3296244 CCGGGTAGAGTGCAGTGGTGCGG - Intronic
1170612315 20:17924810-17924832 CAGATTAGAGTGCAGTGGTGCGG - Intergenic
1170932959 20:20785430-20785452 CACAGCAAGGTGCAGTGTGGGGG + Intergenic
1171288841 20:23968003-23968025 CACAGTAGCCTGCAGTGATGTGG + Intergenic
1171376466 20:24697329-24697351 CACAGCAGCTTGCAGTGGCTGGG - Intergenic
1172205154 20:33158081-33158103 GAAAGCAGAGTGCAGAGATGTGG - Intergenic
1172264747 20:33601307-33601329 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1172364709 20:34340082-34340104 CAGGGTGGAGTGCAGTGGTGTGG - Intergenic
1172592434 20:36127271-36127293 CCCAGCTGATTGCAGTGATGAGG + Intronic
1172862719 20:38068039-38068061 CAGAGCAGAGTGCAACTGTGGGG - Intronic
1174068290 20:47881720-47881742 CACTGAAGAGTCCAGAGGTGTGG + Intergenic
1174499518 20:50974259-50974281 CAGTCTAGAGTGCAGTGGTGTGG - Intergenic
1174843274 20:53919509-53919531 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1175050317 20:56149653-56149675 CCCAACTAAGTGCAGTGGTGAGG - Intergenic
1175970734 20:62685367-62685389 CACAGCAGAGTGGAAGGGAGCGG - Intronic
1176478745 21:7258718-7258740 CAGAACAGAGTGGAGTGGAGTGG + Intergenic
1176752224 21:10700104-10700126 CACAGTGGAGTGGAGTGGAGAGG - Intergenic
1176757040 21:10733270-10733292 CAGAGCAGAGAGGAGTGGAGTGG - Intergenic
1176757574 21:10736970-10736992 TATAGTAGAGTGCAGTGGAGTGG - Intergenic
1176803564 21:13457620-13457642 CTAGGCAGAGTGCAGTGGTGAGG - Intergenic
1176865262 21:14047184-14047206 CGGAGCAGAGTGGAGTGGAGTGG + Intergenic
1177153804 21:17481678-17481700 CAGGCTAGAGTGCAGTGGTGTGG + Intergenic
1177546303 21:22562784-22562806 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1177615009 21:23505462-23505484 CCCAGCAGAGTGCAGGGTGGAGG + Intergenic
1178861357 21:36292299-36292321 CAGGTTAGAGTGCAGTGGTGCGG + Intronic
1179047120 21:37855966-37855988 CACAGCAGAAGGCAGGGGAGAGG + Intronic
1179301840 21:40118782-40118804 CACAGCACAGTGCAGGAGCGCGG - Intronic
1180148957 21:45937943-45937965 CACAGCTGTGTGCAGAGGAGGGG + Intronic
1181562419 22:23713644-23713666 CAGACCAGAGTGCAGTGGCGTGG + Intergenic
1181610054 22:24006215-24006237 GACAGCAGGGTGCAGTGGAGTGG + Intergenic
1181936827 22:26445007-26445029 AAAACCAGAGTGAAGTGGTGAGG + Exonic
1182483760 22:30626929-30626951 AACAGCAGAGTGGAGAGCTGGGG - Exonic
1182675272 22:32034336-32034358 CACAGGTGAGTGCCGTGGTGAGG + Intergenic
1182950952 22:34375332-34375354 ACCAGCAGAGTGGAGTGGGGTGG + Intergenic
1183365810 22:37406348-37406370 CACAACGGAGTGCCGGGGTGTGG + Intronic
1183413289 22:37667869-37667891 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
1183460939 22:37950155-37950177 CACACTGGAGTGCAGTGGTATGG + Intronic
1183462633 22:37961445-37961467 GAAAGCACAGAGCAGTGGTGGGG + Intronic
1183833610 22:40434232-40434254 CACTGGAGAGTACAGTGTTGGGG - Intronic
1184258200 22:43299004-43299026 CAGGCCAGAGTGCAGTGGTGCGG - Intronic
1185011418 22:48316715-48316737 CTCAGCAGAGTGGAGGGCTGTGG - Intergenic
1185061379 22:48608730-48608752 AACTGCAGAGTGCCGTGGAGGGG + Intronic
952093817 3:29924142-29924164 CAGAGCAGAGTGGAATGGTTTGG - Intronic
953625201 3:44565341-44565363 CCCAGTAGACTGTAGTGGTGGGG + Intronic
953915210 3:46914859-46914881 CACGCTGGAGTGCAGTGGTGCGG - Intergenic
954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG + Intronic
954688291 3:52382466-52382488 CACAGCAGAGGGCAGGGCTCGGG + Intronic
954760573 3:52870830-52870852 CTCAGCAGAGTGCTGAGGTCAGG + Intronic
955125028 3:56102515-56102537 CACAGCAGAGTTCAGCAATGAGG + Intronic
955580788 3:60419071-60419093 AACAGCAGAGCACAGTGGTTTGG + Intronic
957263721 3:77933381-77933403 AACTGCAGAGTGTGGTGGTGAGG + Intergenic
958776710 3:98492997-98493019 TAGAGCAGAGTACAGTGGAGTGG + Intergenic
959066054 3:101658268-101658290 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
959584831 3:108016182-108016204 CACAGCACAATCAAGTGGTGGGG - Intergenic
959720952 3:109488425-109488447 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
959938634 3:112057332-112057354 AGCAGCAGAGAGCAGTGGTGGGG - Intronic
960151531 3:114253605-114253627 CCCTGCAGATTGTAGTGGTGAGG + Intergenic
960219431 3:115087643-115087665 CACAGCAGTTTTCAGTGTTGGGG - Intronic
960957033 3:123039889-123039911 CGCAGCAGAGGGATGTGGTGTGG + Intergenic
961316752 3:126041972-126041994 CACAGCATGGTGCAGTTGGGAGG + Intronic
961645334 3:128389767-128389789 GCCAGCAGAGTGATGTGGTGTGG + Intronic
961736118 3:129003128-129003150 CACTGCAGAGTGCAGGGAAGTGG + Intronic
962306256 3:134289220-134289242 GAGTGCAGAGTGCAGTGGCGTGG - Intergenic
962772767 3:138628527-138628549 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
963604839 3:147405306-147405328 AAGAGCAGCATGCAGTGGTGTGG + Intronic
963882032 3:150538926-150538948 CAGAGAAGGGTGCACTGGTGTGG + Intergenic
965738563 3:171848622-171848644 CAGAGTAGAGTGGAGTGGAGTGG + Intronic
965840138 3:172895378-172895400 CAAGGCGGAGTGCAGTGGTGTGG + Intronic
965943011 3:174208307-174208329 CAAAGCAAAGGGCAGGGGTGAGG + Intronic
966716129 3:183014756-183014778 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
967139991 3:186549241-186549263 CAAACTGGAGTGCAGTGGTGCGG - Intronic
967989426 3:195120256-195120278 AGCAGCAGAGGGCAGTGGTGGGG - Intronic
968049366 3:195643492-195643514 CACAGCAGAGGGCAGGGCAGAGG + Intergenic
968098037 3:195946132-195946154 CACAGCAGAGGGCAGGGCAGAGG - Intergenic
968305252 3:197646440-197646462 CACAGCAGAGGGCAGGGCAGAGG - Intergenic
968869956 4:3236760-3236782 CACAGCAGTGGGGGGTGGTGGGG - Intronic
969396396 4:6924448-6924470 CCAAGCAGAGGGCACTGGTGAGG + Intronic
969609686 4:8219974-8219996 GGCGGCAGAGTGCAGTGATGTGG - Intronic
969616494 4:8255905-8255927 CACAGCGGGGTGCAGTGCAGGGG + Intergenic
969922224 4:10551287-10551309 CACGCTGGAGTGCAGTGGTGTGG + Intronic
970510140 4:16773777-16773799 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
973265945 4:48210438-48210460 CAGACTGGAGTGCAGTGGTGTGG - Intronic
973652031 4:53006047-53006069 CAAAGCAGATTGCAGTCATGAGG - Intronic
973966404 4:56166627-56166649 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
974309557 4:60187493-60187515 CACTTCAGCTTGCAGTGGTGAGG - Intergenic
977097737 4:92767704-92767726 CAGACTGGAGTGCAGTGGTGTGG - Intronic
977299677 4:95253753-95253775 CAAAGCAGAGTGCTGTGATATGG - Intronic
979250730 4:118564376-118564398 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
979875628 4:125887582-125887604 CAGACTAGAGTGCAATGGTGGGG + Intergenic
980870080 4:138601299-138601321 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
981630545 4:146813937-146813959 CAAACTGGAGTGCAGTGGTGTGG - Intronic
983241193 4:165235243-165235265 CAGGCTAGAGTGCAGTGGTGCGG + Intronic
984074493 4:175157851-175157873 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
984854999 4:184187403-184187425 CTGAGCGGTGTGCAGTGGTGTGG - Intronic
985158932 4:187024105-187024127 CACAGCAGAGTGGAGAAGGGTGG - Intergenic
985257764 4:188086547-188086569 CACACCAGAGTGCATTTGGGAGG + Intergenic
985705358 5:1397521-1397543 CTCGGCCGAGTGCAGGGGTGAGG + Intronic
985830008 5:2221299-2221321 CATAGCAGGGGGCAGTGGTTCGG + Intergenic
987133332 5:14879406-14879428 CACAGCCCACTGCAGTGGAGGGG + Intergenic
988193401 5:27968179-27968201 AAGACCAGAGAGCAGTGGTGTGG - Intergenic
988585656 5:32505359-32505381 CACAGCAGAGGGCGGGGGAGTGG + Intergenic
988827423 5:34952005-34952027 GACAGCAGAGTGGTGTGGGGAGG - Intronic
989170304 5:38466651-38466673 CACAGCAGGGTGCAGTAGGGAGG + Intergenic
989622765 5:43401036-43401058 CACACTGGAGTGCAGTGGCGTGG - Intronic
990214370 5:53514149-53514171 CACTCCAGGCTGCAGTGGTGAGG + Intergenic
990278368 5:54224114-54224136 CTCAGCAGAGTGGAGTGAGGAGG + Intronic
990589976 5:57252433-57252455 CAGGCCGGAGTGCAGTGGTGCGG + Intronic
990928450 5:61057051-61057073 CACAGCAGCCTGCAGTTCTGGGG + Intronic
990954025 5:61326085-61326107 CAATGCAAAGTGCAATGGTGAGG - Intergenic
991644628 5:68789390-68789412 CACAGCAGTGTCCAGGGGTGAGG - Intergenic
991694654 5:69259029-69259051 CAGACTAGAGTGCAGTGGTGAGG - Intronic
992384202 5:76268052-76268074 CACACAAAAGTGCAGTGGAGGGG + Intronic
992728543 5:79634379-79634401 CAGGCTAGAGTGCAGTGGTGTGG + Intronic
993492159 5:88565525-88565547 CACGGCACAGTGCAGCAGTGAGG + Intergenic
993642934 5:90427522-90427544 CACCTCATAGTGGAGTGGTGTGG + Intergenic
995741779 5:115363540-115363562 CTCAGCAGACTGCAGTGTGGGGG + Intergenic
997184554 5:131868615-131868637 GGCAGCAGTGTGCAGAGGTGTGG + Intronic
997217906 5:132129648-132129670 CACAGCCAAGGGAAGTGGTGAGG - Intergenic
997322691 5:132991746-132991768 CACACTGGAGTGCAATGGTGCGG + Intergenic
997568486 5:134907287-134907309 CAGACTGGAGTGCAGTGGTGCGG + Intronic
997832454 5:137162554-137162576 CACAACTGTGTGCAGAGGTGGGG + Intronic
998253002 5:140564997-140565019 CTCAACAGTGTGGAGTGGTGTGG + Exonic
999151666 5:149430427-149430449 GACAGCAGAGGGCAGTCCTGGGG + Intergenic
999174848 5:149624941-149624963 CAGGGTGGAGTGCAGTGGTGTGG + Intronic
999277735 5:150342907-150342929 CAGGCCAGAGTGCAATGGTGAGG + Intergenic
999309446 5:150542545-150542567 GCTACCAGAGTGCAGTGGTGAGG + Intronic
1000719384 5:164688094-164688116 CAGACTCGAGTGCAGTGGTGTGG + Intergenic
1000755031 5:165147660-165147682 CAATGCAGAGTGGAGTGGTGGGG - Intergenic
1000918458 5:167110087-167110109 CAAGGCAGGGTGCAGGGGTGGGG + Intergenic
1001105167 5:168847027-168847049 CTCAGCAAACTGAAGTGGTGGGG + Intronic
1003353686 6:5344831-5344853 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1004168667 6:13278381-13278403 GCCAGCAGAGGGCAGAGGTGTGG - Intronic
1004665082 6:17741882-17741904 GACTGCAGAGGACAGTGGTGAGG + Intergenic
1006236645 6:32639139-32639161 CACACCAGAGTGCCCTGGTCAGG + Intronic
1007219681 6:40268667-40268689 CAAAGCAGAGTAGAGGGGTGAGG - Intergenic
1007410463 6:41658374-41658396 CACAGCAGGGGGCAGGGCTGGGG + Intergenic
1007557392 6:42778230-42778252 AACATTAGAGTCCAGTGGTGTGG - Intronic
1008054779 6:46935396-46935418 GACACCAGGGTGGAGTGGTGGGG - Intronic
1009558292 6:65203307-65203329 TACAGCAGTGTGCAGTGCTAGGG + Intronic
1009957140 6:70469672-70469694 AGCAGCATAGTGCAGTGGTTAGG - Intronic
1011935896 6:92776759-92776781 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1013551537 6:111212202-111212224 ATCAGCAGAGGGCTGTGGTGAGG + Intronic
1013592671 6:111632369-111632391 GGCAGCACAGTGCAGAGGTGAGG + Intergenic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1014282842 6:119461018-119461040 GACAGCTTAGTGGAGTGGTGAGG + Intergenic
1015716684 6:136199779-136199801 CAGACTAGAATGCAGTGGTGTGG - Intergenic
1015831025 6:137369154-137369176 CACAGCAGAGGGCAGAGGGCTGG + Intergenic
1015868633 6:137753622-137753644 AATAGAAGAGTGGAGTGGTGTGG + Intergenic
1017342548 6:153342323-153342345 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1018481827 6:164198980-164199002 CACACCATGGTGCAGTGTTGAGG + Intergenic
1019024820 6:168950683-168950705 CACAGAAGGGTGCAGGGGTCTGG - Intergenic
1019499320 7:1356550-1356572 CACGCTGGAGTGCAGTGGTGTGG + Intergenic
1019622113 7:1997694-1997716 CACAGCCCAGTGCGGTGGCGGGG + Intronic
1019793322 7:3031711-3031733 CACCGCACAGTGCACTGGAGAGG - Intronic
1020183594 7:5941697-5941719 CAGGGTGGAGTGCAGTGGTGAGG - Intronic
1020299319 7:6783073-6783095 CAGGGTGGAGTGCAGTGGTGAGG + Intronic
1020556872 7:9681558-9681580 GACAGAAGAGTGAAGTGTTGGGG - Intergenic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1023460361 7:40389767-40389789 CATATCAGAGTGCAGTAGTTAGG - Intronic
1025928681 7:65978820-65978842 CAGACCAGAGTGCAGTGGTGTGG + Intronic
1026552967 7:71383481-71383503 CAGACTAGAGTGCAGTGGTGCGG + Intronic
1026663276 7:72320788-72320810 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1026896019 7:74010505-74010527 CACAGCTGTCTGCAGTGGTGGGG - Intergenic
1029515475 7:101020635-101020657 CACAGCAGGGTGTGCTGGTGTGG - Intronic
1030050217 7:105531160-105531182 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
1030538079 7:110793373-110793395 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1031259331 7:119497655-119497677 CAGGCCAGAGTGCAGTGGTGAGG + Intergenic
1031732552 7:125316535-125316557 CACTTCAGTCTGCAGTGGTGAGG - Intergenic
1033113431 7:138604006-138604028 CCAAGCTGAGTGCAGTGGTGTGG + Intronic
1033364378 7:140660263-140660285 CACCGCAGAGTCCAGTTGTTTGG - Intronic
1034786811 7:153933982-153934004 AACAGCAGAGTTCAGTTGTGAGG + Intronic
1035727144 8:1831696-1831718 CACTGCAGAGTCCTGTGCTGCGG + Intronic
1036065458 8:5376233-5376255 CACAGCACAGTGGAGAGTTGTGG + Intergenic
1036601092 8:10260677-10260699 AACAGCAGTTTGCATTGGTGGGG + Intronic
1037893635 8:22637315-22637337 GGCAGCAGAGTGCAGAGGAGAGG + Intronic
1038027366 8:23603823-23603845 CAGGCTAGAGTGCAGTGGTGCGG + Intergenic
1038185373 8:25268956-25268978 GACAGCAGAGAGCAGAGGAGAGG - Intronic
1038432950 8:27514587-27514609 TACAGCACAGTGCAGTGTTGTGG + Intronic
1038529241 8:28304191-28304213 CAAAGGAGAGTGCAGTGGAAAGG + Intergenic
1039005553 8:33032548-33032570 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1039495364 8:37976172-37976194 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1039580070 8:38658369-38658391 AACAGCAGAGTGCAGTTGATTGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1041117153 8:54550937-54550959 CCCAGCAGTGTGCTGTGGGGAGG - Intergenic
1042347664 8:67744553-67744575 CACAGCTGAGTGGAGGAGTGAGG + Intronic
1043209843 8:77498426-77498448 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1045283593 8:100771194-100771216 TACAGCAGAGTGTAGTGGAAAGG + Intergenic
1047293297 8:123549237-123549259 CACACTGGAGTGCAGTGATGCGG + Intergenic
1047425986 8:124747570-124747592 CAGGCTAGAGTGCAGTGGTGTGG + Intergenic
1047868535 8:129056667-129056689 CAGACTACAGTGCAGTGGTGAGG + Intergenic
1047958474 8:129993815-129993837 CAGGCTAGAGTGCAGTGGTGCGG - Intronic
1048109163 8:131448305-131448327 CAGGCCAGAGTGCAGTGGTGCGG + Intergenic
1048174958 8:132143394-132143416 CACTGCATAGTCCAGTGGGGCGG - Intronic
1048814262 8:138316933-138316955 CAGGCTAGAGTGCAGTGGTGCGG - Intronic
1049011471 8:139890370-139890392 CTGAGAAGAGTGCAGTGGTAGGG - Intronic
1049273033 8:141706191-141706213 GGGAGGAGAGTGCAGTGGTGAGG - Intergenic
1049275585 8:141718567-141718589 CACCGCAGAGGGGAGTGCTGAGG - Intergenic
1049389344 8:142360101-142360123 CTCAGCAGAGTGCTTTGGTTGGG - Intronic
1049495958 8:142933484-142933506 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1049534208 8:143170557-143170579 CACAGCAGAGTGACGGGATGTGG + Intergenic
1049688155 8:143947277-143947299 CACAGCAAAGGGCAGGGGTTGGG - Intronic
1049796277 8:144498630-144498652 CACACCAGAGCCCAGGGGTGGGG - Intronic
1051383840 9:16485762-16485784 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1051424403 9:16919020-16919042 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1051679610 9:19593954-19593976 CACTGCTGGGTGCAGTGCTGTGG - Intronic
1052796905 9:32931342-32931364 GACTGCAGAGGACAGTGGTGTGG - Intergenic
1052948716 9:34190332-34190354 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1053208129 9:36205293-36205315 CACACCAGAGAGCAGTCCTGTGG - Intronic
1053611707 9:39720430-39720452 CACACTAGAGTGCAATGATGTGG + Intergenic
1053660568 9:40273689-40273711 CAGGCCAAAGTGCAGTGGTGTGG - Intronic
1054086548 9:60750725-60750747 CACACTAGAGTGCAATGATGTGG - Intergenic
1054241814 9:62621964-62621986 CACACTAGAGTGCAATGATGTGG - Intergenic
1054524043 9:66102595-66102617 CAGGCCAAAGTGCAGTGGTGTGG + Intergenic
1054555938 9:66656486-66656508 CACACTAGAGTGCAATGATGTGG - Intergenic
1054755160 9:68950319-68950341 AACAGCAGAGTGAAATGGTCAGG - Intronic
1054929704 9:70623319-70623341 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1055224578 9:73979411-73979433 CACAGCACAGCACAGTGCTGTGG + Intergenic
1055900015 9:81223414-81223436 CAGGCTAGAGTGCAGTGGTGTGG - Intergenic
1055900427 9:81227917-81227939 CACAGCAAAGTGCAGTATTAAGG + Intergenic
1056200239 9:84268588-84268610 CAGGCTAGAGTGCAGTGGTGGGG + Intergenic
1056934279 9:90903874-90903896 CACAGCAGCAGGCAGTTGTGGGG - Intergenic
1057038494 9:91830425-91830447 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1057505786 9:95632399-95632421 CACAGCAGTGTGCCCTGGTGTGG + Intergenic
1058470953 9:105278291-105278313 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1058511517 9:105723877-105723899 CAGACCAGAGTGCAATGGTGTGG + Intronic
1058748914 9:108019674-108019696 CATAGCAGAGAGCTGTGGAGGGG + Intergenic
1059096180 9:111417192-111417214 CAGGCTAGAGTGCAGTGGTGTGG - Intronic
1059317095 9:113435213-113435235 CAAACTGGAGTGCAGTGGTGTGG + Intergenic
1059931743 9:119267589-119267611 CAGGGTAGAGTGCAATGGTGTGG - Intronic
1060185607 9:121562270-121562292 CAGAGCTCAGTGGAGTGGTGGGG - Intergenic
1061294259 9:129668206-129668228 CACAGCAAGTGGCAGTGGTGGGG - Intronic
1061631915 9:131877529-131877551 CAGACTAGAGTGCAGTGGTGTGG - Intronic
1061664227 9:132151033-132151055 CAGGCCAGAGTGCAGTGGTGAGG - Intergenic
1062340428 9:136091610-136091632 CTCAGCAGAGCGCAGTGGGCAGG - Intronic
1062585096 9:137245603-137245625 CACAGGAGGGTGCAGGGCTGGGG + Intronic
1203445264 Un_GL000219v1:48310-48332 CAGGCCAGAGTGCAGTGGCGTGG + Intergenic
1203342191 Un_KI270442v1:498-520 CAGAGTGGAGTGCAGTGGAGTGG + Intergenic
1203347092 Un_KI270442v1:42668-42690 CAGAGCAGAGAGGAGTGGAGTGG + Intergenic
1185569292 X:1121016-1121038 CAGGCCGGAGTGCAGTGGTGTGG + Intergenic
1185671713 X:1815092-1815114 CAAACTGGAGTGCAGTGGTGAGG - Intergenic
1185883599 X:3761926-3761948 CACAGCAAAATACAGTGGTGAGG + Intergenic
1185953498 X:4462741-4462763 CAGACTGGAGTGCAGTGGTGAGG - Intergenic
1188408338 X:29839879-29839901 CAGGTTAGAGTGCAGTGGTGCGG - Intronic
1188763338 X:34058360-34058382 CACAGAAGTGTGCAGTGGGGAGG + Intergenic
1189261399 X:39681331-39681353 GACAGCAGAGTACAGTGGGAAGG - Intergenic
1189414874 X:40804748-40804770 AACAGCAGAGTGCAGAAGAGGGG + Intergenic
1190960398 X:55241028-55241050 CACAGCATAGCACAGTGGTTGGG + Intronic
1192592135 X:72369112-72369134 CACAGGAGAGTTGAGGGGTGTGG - Intronic
1193396525 X:80990403-80990425 CACTCCAGCTTGCAGTGGTGAGG - Intergenic
1193535395 X:82709397-82709419 CACACAAGTGTGCAGTGGAGTGG + Intergenic
1195281285 X:103336470-103336492 CACAGAAAAGTGCAGTAATGGGG + Intergenic
1196421682 X:115528717-115528739 CACCGCTGTGTGCAGGGGTGGGG + Intergenic
1196781176 X:119385783-119385805 CACAGGAGAGAGTAGTGGCGAGG + Intergenic
1199363311 X:146947268-146947290 CAGGGTGGAGTGCAGTGGTGCGG + Intergenic
1199648684 X:149934525-149934547 GACAGTGGAGAGCAGTGGTGGGG - Intronic
1199999842 X:153054428-153054450 CAGATCAGATTGCAGAGGTGGGG + Intergenic
1200066244 X:153505379-153505401 TACAGCAGAGGGCAGGGGTCCGG + Intronic
1200279705 X:154766386-154766408 CACAACAGAGTGCAGGTATGTGG + Exonic
1201097471 Y:10632414-10632436 TGCAGCAGAGTGGAGTGGAGAGG - Intergenic
1201098426 Y:10652984-10653006 TATAGCAGAGTGGAGTGGAGTGG - Intergenic
1201100575 Y:10668590-10668612 TGCAGCAGAGTGGAGTGGAGTGG - Intergenic
1201107392 Y:10773335-10773357 CAAAGTGGAGTGGAGTGGTGTGG - Intergenic
1201111822 Y:10804983-10805005 CAGAGCAGAATGTAGTGGAGTGG - Intergenic
1201115874 Y:10834985-10835007 CAGAGTAGAGTGGAGTGGAGTGG - Intergenic
1201117420 Y:10845302-10845324 CAGATCAGAGTGAAGTGGAGAGG - Intergenic
1201127421 Y:10927618-10927640 TGCAGCAGAGTGGAGTGGAGTGG - Intergenic
1201128388 Y:10934195-10934217 CACAACTGAGTGGAGTGGAGTGG - Intergenic
1201624714 Y:16002109-16002131 CACACCAGTATGCAGTGATGAGG - Intergenic
1202607165 Y:26648922-26648944 CGGAGCAGAGTGCCGTGGAGTGG + Intergenic