ID: 954643401

View in Genome Browser
Species Human (GRCh38)
Location 3:52115761-52115783
Sequence AGTCCAAGCAAAGCACCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954643401 Original CRISPR AGTCCAAGCAAAGCACCAAC GGG (reversed) Intronic
904398252 1:30237740-30237762 ATCCCAAGCACAGCACCAAGGGG + Intergenic
905104183 1:35553328-35553350 TGTCCCAGCAAAGCATCATCTGG + Intronic
905281531 1:36852475-36852497 TCTCCAAGAAATGCACCAACTGG - Intronic
908395922 1:63725619-63725641 ATCCCAAGAACAGCACCAACGGG + Intergenic
915228127 1:154426212-154426234 AGTTCGAGAAAAGCACCAGCTGG + Intronic
922083668 1:222324538-222324560 AGTCCAAGCACAGCTCCCATAGG + Intergenic
1069043908 10:63722773-63722795 AGTCCAAGCAAATCAGTCACAGG - Intergenic
1069192548 10:65508082-65508104 AGTGGAAGCAAAGCAGCAATCGG - Intergenic
1070528612 10:77316733-77316755 TGTCAAACCAAAGCACCAAGAGG + Intronic
1077483579 11:2827959-2827981 AGTCCAAGCCAGGCACCACCGGG + Intronic
1078918323 11:15801912-15801934 AGTCCAAGAAAAACACGGACCGG - Intergenic
1086734849 11:90293770-90293792 AGTCCAGTCAAAGCACAAGCAGG - Intergenic
1092151528 12:6252181-6252203 AGGCCAAGCAAAGTAGCAATGGG - Intergenic
1093702766 12:22241335-22241357 ATTGCAAGGAAAGCACCAAGGGG - Intronic
1096009382 12:48200024-48200046 ATTCCAAACAAGGCACCCACAGG - Intergenic
1104984350 12:132588121-132588143 AGTCCAAGCAACCCACCCCCTGG + Intergenic
1107042263 13:35961383-35961405 AGTACAAGGAAAGGACAAACTGG - Intronic
1107572306 13:41675858-41675880 AGTAAATGCAAAGCACCGACAGG + Intronic
1108714277 13:53063631-53063653 AGACCGAGCAAAGAACCCACGGG - Intergenic
1112204395 13:97309658-97309680 AGCCCAAGCAAACCAACAGCTGG + Intronic
1112646556 13:101339619-101339641 AGCCTAAGTAAAGCACCAGCTGG - Intronic
1113218899 13:108075250-108075272 ATACCAGGCAAAGTACCAACAGG + Intergenic
1114408253 14:22476254-22476276 AGTTACAGCACAGCACCAACAGG + Intergenic
1115197697 14:30819427-30819449 AGCCAAAGTAAAGCACAAACAGG + Intergenic
1115377079 14:32688795-32688817 AGTCCAAGCATAGCACTCTCTGG + Intronic
1115506672 14:34099877-34099899 AGAGCAAGCCAAGCTCCAACAGG + Intronic
1118037196 14:61880506-61880528 ACTCCAATCAAAACCCCAACAGG - Intergenic
1118265718 14:64293559-64293581 AGACCAAGCTAAGCTCTAACTGG - Intronic
1120580273 14:86239345-86239367 AAACTAAGCAAATCACCAACAGG - Intergenic
1124171192 15:27375430-27375452 AGTCCCAGCAAAGCATCAGACGG + Intronic
1126363846 15:47873211-47873233 AGTCCTAGCAAAGCACACAAAGG + Intergenic
1126500983 15:49344605-49344627 AGTCCAAGCTAAGCAAGACCAGG - Intronic
1138486495 16:57348372-57348394 AAGCAAAGCAAAGCAGCAACAGG - Intergenic
1139778815 16:69334185-69334207 AGTCCAGGCACAGCACAACCGGG - Intronic
1141339637 16:83191047-83191069 ATTCCGAGCAAAGGTCCAACTGG + Intronic
1141607069 16:85159982-85160004 AGTCCAAGCAAACAAGCAGCAGG - Intergenic
1153467966 18:5410768-5410790 AGTTCAAGCAAAGCAACAGAAGG + Intronic
1158069247 18:53451140-53451162 CCTCCAAACTAAGCACCAACAGG - Intronic
1164963269 19:32455739-32455761 AATCTTAGCAAAGCACCTACTGG - Intronic
929127194 2:38532801-38532823 AGGCCAAGCAAACAACCATCTGG + Intergenic
937344265 2:121114318-121114340 ATTCCAATCAAAACACCAACAGG + Intergenic
940355298 2:152735036-152735058 TGTCCAAGAAAAGCTGCAACAGG - Exonic
942463152 2:176183410-176183432 AGTCTCTGCAAAGCACCAATTGG + Intergenic
945613571 2:212037379-212037401 AGCCTAAGGAAAGCACCAACTGG + Intronic
946694715 2:222343343-222343365 AGTTTAAACAAAGCACCAATAGG - Intergenic
1171460930 20:25297547-25297569 TGTCCAAGCAGAGCACAAATGGG - Exonic
1173274428 20:41567039-41567061 AGTGCAAGCCCAGCAGCAACTGG - Intronic
1173649877 20:44656380-44656402 AGTTTAAGGAAAGCAACAACGGG - Intergenic
1175168153 20:57060990-57061012 AGTTTCAGCAAAGCACCAACAGG - Intergenic
1185102928 22:48851196-48851218 AGTCCCATCAACTCACCAACTGG - Intergenic
950932519 3:16804781-16804803 ATACCAAGCAAAACATCAACAGG + Intronic
952008383 3:28869737-28869759 ATTTCAAACAAAGCACCAAAAGG - Intergenic
952860242 3:37806885-37806907 AGTCCAGGCAAAGCAAGGACTGG - Intronic
953509135 3:43517661-43517683 AATCCAAGCAAGGTGCCAACAGG - Intronic
954643401 3:52115761-52115783 AGTCCAAGCAAAGCACCAACGGG - Intronic
958682203 3:97345339-97345361 AGTGCAAGGAAAGCAGCAAGAGG + Intronic
962433575 3:135344234-135344256 AGTCAAGGTAAAGAACCAACAGG + Intergenic
963275776 3:143328650-143328672 AGTTCAAGCAAATTACCACCAGG - Intronic
964201378 3:154122105-154122127 AGTCCTACCAGAGCCCCAACGGG + Exonic
964260734 3:154833544-154833566 ATTTCAATCAAAGCACCAATAGG - Intergenic
969727494 4:8930584-8930606 AGTCCAAGCATATCATGAACAGG + Intergenic
974811906 4:66956407-66956429 AGGCCAAACAAAGGACCTACAGG + Intergenic
975136634 4:70881148-70881170 AGTACAAGCAAAACAACAACTGG - Intergenic
980560530 4:134467533-134467555 AGTCCAAGAAAAACATCAAAGGG + Intergenic
980890264 4:138807385-138807407 AGCCCAAGGAAAGCACTAAAAGG + Intergenic
981021757 4:140036568-140036590 AGTCCAAGCACAGCTCCAGCAGG + Intronic
985867719 5:2528435-2528457 AGTGTAACCACAGCACCAACTGG + Intergenic
988357555 5:30198417-30198439 AGTACAAGAAAAGCAGAAACTGG - Intergenic
988493553 5:31725867-31725889 AGTCCTAGAAAAAGACCAACTGG - Intronic
990976270 5:61564456-61564478 TGTCCCAGCAAAGCAGGAACTGG - Intergenic
992448927 5:76858188-76858210 AGTCCAGTCATGGCACCAACTGG + Intronic
1000656530 5:163885957-163885979 AGTACAGGCAAAGTACCCACAGG - Intergenic
1002338836 5:178501280-178501302 AGACCAAAAAAAGCCCCAACAGG + Intronic
1013297723 6:108774548-108774570 AGTCCCAGCACAGCAAGAACGGG + Intergenic
1015920390 6:138260320-138260342 ACTCCAAGCAAAGCAGGAAAAGG - Intronic
1016915869 6:149244106-149244128 AATCAAAGGTAAGCACCAACAGG + Intronic
1018253370 6:161894523-161894545 GGTCCAAGCAAAGCACTAAATGG - Intronic
1027755460 7:82205178-82205200 AGCCCAAGCTAAGGACCAAGGGG - Intronic
1030125481 7:106149030-106149052 AGTCCCTGGAAAGGACCAACTGG - Intergenic
1035083860 7:156239605-156239627 AGATGAAGCACAGCACCAACTGG + Intergenic
1039821488 8:41139107-41139129 AGTCAAAGAAAAGCCCCTACTGG - Intergenic
1041704902 8:60836233-60836255 TGTCCAAGCAGCGCACCATCTGG - Exonic
1044281612 8:90363075-90363097 CATCAAAGCAAAGCAACAACAGG - Intergenic
1044655507 8:94544164-94544186 AGTCTAAGCAAAACATCAGCAGG - Intronic
1046900175 8:119515383-119515405 AGGCAAAGCAAAGCCTCAACTGG + Intergenic
1048223463 8:132564089-132564111 AGTCCAGGCACACCACCAGCAGG + Intergenic
1050424831 9:5502182-5502204 TGTGCAAGCAAAGCAACAAGGGG - Intergenic
1053279831 9:36812811-36812833 TGGCCAAGCAAAGCACTAAGTGG + Intergenic
1059627042 9:116078614-116078636 AGTCCAAACAAAACAGCCACGGG + Intergenic
1060209736 9:121702243-121702265 AATCCCAGCACAGAACCAACTGG - Intronic
1060489221 9:124069843-124069865 AGACCCAGCAAGGCACCACCTGG - Intergenic
1061158340 9:128878945-128878967 AGTCCCAGAAAAGCACCAGGAGG + Intronic
1061546662 9:131308488-131308510 AGTCCAAGCAAAGGGGCAAGAGG - Exonic
1189578069 X:42376212-42376234 AGTCTAGGCAAACCAGCAACAGG - Intergenic
1192530721 X:71881974-71881996 ATCCCAATCAAAACACCAACAGG + Intergenic
1194007528 X:88514826-88514848 AATACAAGGAAAGCACCTACTGG - Intergenic
1196595652 X:117542657-117542679 AGTCCAAGCAAAACAGAATCAGG - Intergenic
1198122494 X:133607881-133607903 TGGCCAAGCAAAGCACCAAGTGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200539295 Y:4439448-4439470 AGTCCCATCACAGCACTAACTGG - Intergenic