ID: 954643845

View in Genome Browser
Species Human (GRCh38)
Location 3:52118634-52118656
Sequence CCAGAGGGGCAGACCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954643845_954643852 2 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643852 3:52118659-52118681 TTCGACTGCTACGCTGGAATGGG 0: 1
1: 0
2: 0
3: 2
4: 29
954643845_954643855 14 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643855 3:52118671-52118693 GCTGGAATGGGGACATGGTGAGG 0: 1
1: 0
2: 6
3: 35
4: 395
954643845_954643851 1 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643851 3:52118658-52118680 TTTCGACTGCTACGCTGGAATGG 0: 1
1: 0
2: 1
3: 2
4: 29
954643845_954643853 3 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643853 3:52118660-52118682 TCGACTGCTACGCTGGAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 36
954643845_954643850 -4 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG 0: 1
1: 0
2: 0
3: 2
4: 51
954643845_954643854 9 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643854 3:52118666-52118688 GCTACGCTGGAATGGGGACATGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954643845 Original CRISPR CCAGAGGGGCAGACCCTGCA TGG (reversed) Intronic
900104240 1:975511-975533 CCAGTGCAGCAGCCCCTGCAGGG - Exonic
900123934 1:1061349-1061371 GCAGAGGGGCAGGAGCTGCAAGG + Intergenic
900141803 1:1141821-1141843 CGACCGGGGGAGACCCTGCATGG + Intergenic
900162360 1:1230108-1230130 CCGGAGGGGCAGACTGTGAAAGG - Intronic
900593010 1:3468184-3468206 CCAGAGTTTCCGACCCTGCATGG + Intronic
900615264 1:3562890-3562912 ACAGAGGGGCTGGCCCAGCAAGG - Intronic
900615481 1:3563832-3563854 CCAGACGCGCAGACACCGCAGGG - Intronic
900990889 1:6097796-6097818 GCAGAGGGGCAGATCCTGAGAGG + Intronic
901839128 1:11942922-11942944 CCAGAGAGGCAGGCTCTGCGTGG + Intronic
902540057 1:17148023-17148045 TCTGAGGGGCAGAGCATGCAAGG + Intergenic
902558497 1:17261110-17261132 CCAGAGGGGAGGATCTTGCAGGG - Intronic
902691115 1:18110553-18110575 CCAAAGGGGCAGAACCGGCGAGG - Intronic
903168417 1:21537357-21537379 CCAGAGGAGCTGACCCAGGAGGG + Intronic
903300330 1:22374358-22374380 GCAGGAGAGCAGACCCTGCAGGG + Intergenic
903374086 1:22854833-22854855 CCAGAGGGACTGACTCTGCTGGG + Intronic
904007013 1:27368430-27368452 CCAGAGGGGCATACAGTGGAAGG - Intergenic
906346604 1:45019474-45019496 CCAGATGGCCAGACCCTGTTTGG + Intronic
907315434 1:53567902-53567924 CTACAGGGGCAGAGCCTTCATGG + Intronic
907371303 1:54005247-54005269 CCACAGCAGCAGACCCTGCGGGG + Intergenic
910377798 1:86592740-86592762 TCATGGGGGCAGATCCTGCATGG - Intergenic
910676400 1:89820982-89821004 CCAGAGCTGCAGCGCCTGCACGG + Intronic
912367929 1:109150225-109150247 CCAGTGGGGTAGGCCCTGCCAGG + Intronic
912417207 1:109517673-109517695 TCACTGGGGCAGATCCTGCATGG - Intergenic
915596221 1:156897875-156897897 CCAGGGGGCCAGCCCCTACAAGG - Intronic
916071010 1:161169922-161169944 CCAGAGGGGCAGCCTCAGCAGGG - Exonic
917931327 1:179824649-179824671 CCAGGAGGGCGGTCCCTGCAGGG - Intergenic
920532388 1:206713237-206713259 GCAGAGGGGCTGACTCTGCCTGG + Intronic
920577765 1:207074464-207074486 AGAGAGGTGCAGACCCTGCCAGG + Exonic
922098316 1:222461272-222461294 CCAGGTGGGCAGTCCCTGAAGGG + Intergenic
922216897 1:223527081-223527103 CCAGAGAGGAAGGGCCTGCAGGG - Intergenic
922598629 1:226833278-226833300 CCTGAGTGTCAGATCCTGCAGGG + Intergenic
922698681 1:227745300-227745322 GGAGAGGGGAAGGCCCTGCAGGG - Intronic
922960860 1:229644599-229644621 CCAGGGGGGCAGGCCCTGGTGGG + Intronic
923078210 1:230629180-230629202 CTGGAGGGGCAGTCCCTCCAGGG - Intergenic
923123881 1:231018670-231018692 CCAGAGAGGCAGAGGTTGCAGGG + Intergenic
923541417 1:234890949-234890971 CCACAGGGACAGACCCAGCCTGG - Intergenic
1062824531 10:557930-557952 CCAGAGGGCGAAACCCTGGAGGG + Intronic
1063527022 10:6796104-6796126 CAAGAAGGGCAGGCCCTTCAGGG - Intergenic
1065501927 10:26391714-26391736 CCAGCGGGGCAGGCCCAGCGGGG + Intergenic
1065521164 10:26574264-26574286 TCAGAGGGGCAGTCCCTCCAGGG + Intergenic
1065530184 10:26661526-26661548 TGAGAGGGGCAGTCCCTCCATGG + Intergenic
1065559843 10:26951841-26951863 TGAGAGGGGCAGTCCCTCCAGGG - Intergenic
1067040532 10:42951128-42951150 CCTGAGGAGAAGACCCTGCCAGG + Intergenic
1067080513 10:43209812-43209834 CCAGAGAGCCAGACCCTGCATGG + Intronic
1067293740 10:44962600-44962622 GCAGAGGGGCAGACCCCTCTGGG - Intronic
1069388851 10:67911331-67911353 CCAGAGGCGCACACCATGCTTGG + Intronic
1070741686 10:78907541-78907563 CCAAAAGGGCAGGGCCTGCAAGG - Intergenic
1073127280 10:101159234-101159256 CCAAATGGGCAGAGGCTGCAGGG + Intergenic
1074395685 10:113096159-113096181 GGAGAGGGGTAGACGCTGCAGGG + Intronic
1075726082 10:124611607-124611629 CCACAGGGGCAGTCCCTGGGAGG - Intronic
1076338756 10:129728414-129728436 CCAAGGGGGCGGACCCCGCAGGG + Intronic
1076681785 10:132176113-132176135 GCTGGGGGGCAGATCCTGCAGGG - Intronic
1076694928 10:132242843-132242865 CCAGAGGGGCGGCTCCTCCATGG + Intronic
1077217455 11:1400883-1400905 CCAGAGGAGCAGACGCCACAGGG - Intronic
1077404188 11:2375520-2375542 CCAGAGTTGCAGATCCTCCAGGG + Intergenic
1078699284 11:13665526-13665548 CCGGAGAGGCAGAGCTTGCAGGG + Intergenic
1080587211 11:33693075-33693097 GCTGAGGGGGAGCCCCTGCAGGG - Intergenic
1080641254 11:34159789-34159811 TCTGAGGGGCAGAGGCTGCAGGG + Intronic
1081406815 11:42707788-42707810 GCAGAGGTGCAGATCCTGCTGGG + Intergenic
1081845724 11:46239060-46239082 CCAGAGGCGCAGCCCCTGCGGGG + Intergenic
1082064103 11:47884937-47884959 CCTGAGTGGAAGACCCAGCAAGG - Intergenic
1083418737 11:62541860-62541882 TCAGAGGGCCAGGCCCTGGAAGG - Intronic
1083419957 11:62546919-62546941 CGAGCGGGGCAGACCCTGGAGGG + Intronic
1084259457 11:67966052-67966074 CCAGGGGGTCGGGCCCTGCAGGG + Intergenic
1085400075 11:76230584-76230606 CCCCAGGGGCTGACCCTGCTTGG - Intergenic
1085509812 11:77082540-77082562 GCAGAGGGGCAGTCTGTGCAAGG + Intronic
1085520501 11:77136419-77136441 CCCCTGGGGGAGACCCTGCAAGG - Intronic
1089299443 11:117489785-117489807 CCTGCGGGGCATCCCCTGCATGG + Intronic
1090185643 11:124737637-124737659 CCAGAGACACACACCCTGCACGG - Intergenic
1093754198 12:22834143-22834165 TTAGAGGGGCAGACCTTGGAAGG + Intergenic
1096194099 12:49637725-49637747 CCAGAGGGGTGGAGCCTGTAAGG - Exonic
1096275890 12:50207812-50207834 CCAGGGGGGCAGAGGTTGCAGGG + Intronic
1096542715 12:52317267-52317289 CCAGGGGCTCAGACCCTGTATGG + Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103612939 12:122135146-122135168 GCAGAGAGGCAGCCTCTGCAGGG + Intronic
1103762986 12:123264856-123264878 CCACAGGAGCAGACCAGGCAGGG + Intronic
1104599506 12:130142913-130142935 CCAGTGGGGCCAACCCTGCTCGG + Intergenic
1104617977 12:130286151-130286173 GCAGAAGAGCAGACCCTTCAAGG - Intergenic
1104637600 12:130447821-130447843 ACACAGAGGCAGCCCCTGCATGG + Intronic
1104755505 12:131266811-131266833 CCAGCTGACCAGACCCTGCAAGG + Intergenic
1104943224 12:132404498-132404520 CCTGAGGGGCTGTCTCTGCAGGG + Intergenic
1105306360 13:19171820-19171842 CCCACGGGGCAGACCCTGCCAGG + Intergenic
1106246536 13:27954533-27954555 GCAGCGGCGCAGACCCAGCAAGG + Intergenic
1106358546 13:29008214-29008236 CCTGAGGGGAAAAGCCTGCAGGG + Intronic
1110001064 13:70201307-70201329 CCAGAGGTGAAGACCTTACAAGG - Intergenic
1111334570 13:86803112-86803134 CTGCAGGGGCAGAGCCTGCATGG - Intergenic
1111913262 13:94335145-94335167 CCAGAGGGCCAGAACCACCATGG - Intronic
1112117215 13:96369232-96369254 AGAGAGGGGCAGACACTGCTTGG + Intronic
1112392924 13:99001790-99001812 CCATAGGGGGAGCCCCTGCAAGG - Intronic
1112402011 13:99086106-99086128 GCAGAGCGGCCGACCCTGCTGGG - Intronic
1113031525 13:105998392-105998414 GCAGAGGAGCGGAGCCTGCAGGG - Intergenic
1113343061 13:109446150-109446172 CCAGGGGGTCAGAGCCTTCAAGG - Intergenic
1114271896 14:21105391-21105413 CCAGAAGGGCAATGCCTGCAAGG + Intergenic
1114520635 14:23332667-23332689 CCTGGGGGGCAGAGCTTGCAGGG - Intergenic
1115521141 14:34234051-34234073 CCAGAGGGTCAGCACCTGGAAGG + Intronic
1117236764 14:53786216-53786238 CCAGATGAGCAGACCCTGCCTGG + Intergenic
1117622955 14:57606944-57606966 GCAGAGGGGCAGGCACTGCTAGG - Intronic
1118509005 14:66449700-66449722 CCAGGGGGCCAGACCCTGATGGG + Intergenic
1119168377 14:72514480-72514502 CCACTGGGGCAGCCCCTGGATGG + Intronic
1119390280 14:74286976-74286998 GCAGAGGGCCAGACTCTCCAAGG + Intronic
1122124885 14:99573570-99573592 CCAGTGAGGCAGACCCGGCCTGG + Intronic
1122884085 14:104702887-104702909 CCACAGGGCCAGACCCTGCAGGG - Intronic
1124042572 15:26118699-26118721 TGGGAGGGGCAGTCCCTGCAGGG + Intergenic
1124147204 15:27138968-27138990 CCAGAGAGGAAGACCCAACAGGG + Intronic
1124653664 15:31490206-31490228 CCAGAGGGCAAGCCGCTGCATGG - Intronic
1125576181 15:40757124-40757146 CCAAATGGGCAGACCAAGCAGGG + Intergenic
1125642325 15:41241606-41241628 CCATCGGGGCAGAGCCAGCAGGG - Intronic
1126118821 15:45233097-45233119 CCAGAGGGGAGGATCCTTCAGGG - Intergenic
1127174278 15:56337295-56337317 CTAGAGGGTCAGACCCCTCAAGG - Intronic
1128668921 15:69559623-69559645 ACTGAGGGGCAGTCCCTCCAGGG + Intergenic
1129197818 15:73981627-73981649 GCAGAGGAGAAGTCCCTGCAAGG - Exonic
1129755900 15:78098720-78098742 CCAGAGGTGCGGACCCAGCTTGG + Intronic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131507555 15:93031015-93031037 AGAGAGGGGCAGAGGCTGCAGGG + Intergenic
1131668877 15:94598296-94598318 CCAGAGGATCAGAGGCTGCATGG + Intergenic
1132027668 15:98417003-98417025 CTGGAGGGGCAGTCCCTTCAGGG - Intergenic
1132499686 16:279974-279996 CAAGAGGGGGTGTCCCTGCAGGG - Intronic
1132698761 16:1213382-1213404 CCAGGGGGGCGGGCCCTGCCAGG + Intronic
1132899457 16:2245251-2245273 CCCGAGGGCCAGACCCCCCAAGG + Intronic
1133198933 16:4190520-4190542 GCAGAGGGGCAGGACCTGCAGGG - Exonic
1135421532 16:22308533-22308555 CTAGAGCTGCAGACCCTCCATGG - Intronic
1141535596 16:84677691-84677713 CCAGGGGTTCAGACCCTCCAAGG + Intergenic
1141621008 16:85236387-85236409 CCAGAGGCCCAGACCCAGCCAGG - Intergenic
1141816888 16:86416952-86416974 CCAGAGGGCCAGACGTTGGAGGG + Intergenic
1142008648 16:87702363-87702385 GCAGGGGGGCGGGCCCTGCAGGG + Intronic
1142758448 17:2029272-2029294 CCAGAGGGGCAGTTTCTACAGGG + Intergenic
1142803672 17:2360555-2360577 CCTGAGAGCCAGACCCCGCATGG + Intronic
1143037380 17:4007184-4007206 CCAGAGGGGCAGTCCCAGGGCGG + Intronic
1144755868 17:17680497-17680519 CGGGAGGGCCAGAGCCTGCAGGG - Intergenic
1144870281 17:18365308-18365330 CCAGAGAGGCAGAGGTTGCAGGG - Intergenic
1146126925 17:30237532-30237554 CCCCAGGGGCAGCGCCTGCACGG + Intergenic
1147696983 17:42362793-42362815 CGAGAGGGGCAGAGCCAGCCAGG - Intronic
1147735312 17:42633675-42633697 CCAGAGGGGCAGGCCAGCCAGGG + Intergenic
1148092375 17:45030271-45030293 GCAGAGGGGCAGGCCTTCCAAGG + Intronic
1148239717 17:45992297-45992319 CCATAGAGGCAGCCCCAGCATGG + Intronic
1148467176 17:47872321-47872343 CGGGAGGAGCAGACCCTGCCGGG - Intergenic
1148799295 17:50213184-50213206 CCAGGGGGGAAGCCCCAGCAAGG - Intergenic
1149732837 17:58963309-58963331 CCAGAGAGGCAGAGGTTGCAGGG + Intronic
1150097394 17:62389395-62389417 TGAGAGGGGCAGTCCCTCCAGGG + Intronic
1150479253 17:65496919-65496941 CCCCAGGGGCCCACCCTGCACGG - Intergenic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152237852 17:79147737-79147759 CCAGGGGCGCAGAGCCTGCCTGG - Intronic
1152272009 17:79330311-79330333 CAAGAGGGGAAGCCCCTGCATGG - Intronic
1152290087 17:79435431-79435453 ACACAGCGGCAGATCCTGCATGG - Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1152816642 17:82412023-82412045 CCAGAGAGGAAGACCCTCCTGGG + Intronic
1153009535 18:525480-525502 CCAGAGGGTGAGAACCTGGAAGG - Intergenic
1153190520 18:2532755-2532777 ACAGAGGGGCAGAGGCTGGAAGG + Intergenic
1153724159 18:7937889-7937911 CCAGTGGGGCTTACTCTGCATGG + Intronic
1156090241 18:33459137-33459159 CCAGAGGTGAAAAACCTGCAGGG - Intergenic
1156473333 18:37390934-37390956 GCAGAGGGGCAGCCGCTGCAGGG + Intronic
1156568333 18:38221953-38221975 TCAGAGGGGCACGCCCTGCTGGG - Intergenic
1157405387 18:47418497-47418519 CCAAAGGGGCAGAGCATTCAAGG - Intergenic
1157471779 18:47994402-47994424 CCAGAGGTGCTGATGCTGCAGGG + Intergenic
1157769943 18:50337177-50337199 GCAGAGGGGCAAGCCATGCAGGG + Intergenic
1159993567 18:74940202-74940224 CCAGAGAGGCAGACATTGTATGG + Intronic
1160193002 18:76730555-76730577 CCCAGGGGGCAGAGCCTGCAGGG + Intergenic
1160383986 18:78483139-78483161 CCAAAAGGGCAGACCCTGCCTGG + Intergenic
1160607943 18:80066264-80066286 CCAGAGGGGCACACACTGCATGG - Intronic
1161154737 19:2726776-2726798 CCACAGGGAGAGACCCTGGAGGG + Intronic
1161348014 19:3777640-3777662 CCAGCTGGGCAGATCCTCCATGG + Intergenic
1162178267 19:8847696-8847718 TCATAGGGGCAGATCCTTCATGG + Intergenic
1163514977 19:17757312-17757334 CAAGAGAGGCAGACGCTGCTGGG + Intronic
1163683984 19:18700247-18700269 CCAGAGGGGCTGAGTCTGCTTGG + Intronic
1163789620 19:19298914-19298936 CGAGATGGGCAGACCCTCCAGGG - Intronic
1163818829 19:19484606-19484628 CCCGGGGGGCAGAGCCTGCAGGG - Intronic
1164760269 19:30723208-30723230 CCAGAGGGGCAGACAATGAATGG - Intergenic
1165826600 19:38709297-38709319 CCAGAGGGAGAGACCCGGGAGGG - Intronic
1165834437 19:38745550-38745572 CCAGGGAGGCTGACCCTGGAGGG + Intronic
1166917287 19:46204148-46204170 CCAGAGGGGAAGCCCATGAAAGG + Intergenic
1167016844 19:46846569-46846591 CTAGAGGGGCAGACAAAGCAGGG - Intronic
1167490639 19:49791008-49791030 ACAGAGAGCCAGACCCTGCAGGG - Intronic
1167590068 19:50399539-50399561 CCAGAGGGGCTGACCTGGCCCGG - Intronic
1167590084 19:50399584-50399606 CCAGAGGGGCTGACCTGGCCCGG - Intronic
1167590087 19:50399598-50399620 CCAGAGGGGCAGAGCCAGAGGGG - Intronic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
925383990 2:3449179-3449201 CCAGAGGGAGACAGCCTGCAGGG - Intronic
926208184 2:10848860-10848882 CCACAGGAACAGCCCCTGCATGG - Intronic
927072038 2:19540848-19540870 CCTGAGGGACAGAGTCTGCAAGG - Intergenic
927759630 2:25741254-25741276 CCAGAGAGGCACTCCCTTCACGG + Intronic
930754338 2:54960087-54960109 CCAGAAGGAAAGACCCTCCAGGG - Intronic
932317718 2:70796975-70796997 CCAGGAGGGCAGACCCAGCAGGG - Intergenic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
933578757 2:84101084-84101106 CCAAAAGGGCAGACCCTTAAAGG - Intergenic
933729558 2:85446518-85446540 CCTGAGGGGCAGAGCCCGCAGGG - Intergenic
933891235 2:86772377-86772399 CCCGAGAGGCAGAGCTTGCAGGG + Intronic
934156175 2:89203168-89203190 GCAGAAGGGTTGACCCTGCATGG + Intergenic
934211142 2:89979595-89979617 GCAGAAGGGTTGACCCTGCATGG - Intergenic
935346176 2:102110612-102110634 ACAGTGGGGCTGACACTGCATGG - Intronic
937952891 2:127401889-127401911 CTCTAGGGGCAGCCCCTGCAAGG + Intergenic
937975078 2:127577495-127577517 GCAGAGGGGCAGATCTTGGAGGG - Intronic
938138362 2:128777082-128777104 CCATAGGAGCTGACTCTGCAGGG - Intergenic
938611209 2:132949270-132949292 CTGGAGGGGCAGTCCCTTCAAGG + Intronic
938703437 2:133899423-133899445 CCTGAGGGGCAGACATTGCAGGG - Intergenic
938764057 2:134448781-134448803 CCAGAGGGTCTGCCCCTGCCGGG + Exonic
939667114 2:144965616-144965638 CTTTAGGGGCAGACCCTTCATGG + Intergenic
939960959 2:148565404-148565426 CCAGCGGTGCACACCCTCCAAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
947713551 2:232329105-232329127 CCAGAGCAGCAGCCCCTGAAAGG + Intronic
948120197 2:235523925-235523947 CCAGTAGGGATGACCCTGCACGG + Intronic
948410087 2:237752591-237752613 ACAGAGAGGCAGAACCTTCAGGG - Intronic
948871015 2:240798114-240798136 CCACAGGGGAAGACCCTTCCTGG - Intronic
1170221488 20:13946892-13946914 CCAGAGGGGCTGAGGCAGCAGGG - Intronic
1170385270 20:15809646-15809668 TCAGAGGGGCAGACCCTTCATGG - Intronic
1171464653 20:25319100-25319122 GCACAGAGGCAGACCCAGCACGG - Intronic
1172358469 20:34295636-34295658 CAAGAGGGGCGGTCACTGCATGG + Intronic
1173764516 20:45595537-45595559 CCAGTGTGGCACACCCTTCAAGG - Intergenic
1175272910 20:57747242-57747264 CCAGAGGGGCAGAGCTTTGAGGG + Intergenic
1175392624 20:58636673-58636695 CCAGAGGTGAAGAGCCTGCCAGG - Intergenic
1176026904 20:62990436-62990458 CCATAGAGGCAGCCCCTGCCTGG - Intergenic
1177654867 21:24004114-24004136 CCACAGGGGCAGAGCCCTCATGG - Intergenic
1179828582 21:43982034-43982056 CCAGAGGGGCAGGCAGGGCAAGG + Intronic
1179923804 21:44521722-44521744 CCAGAGGAGCAGGCCCTGCCTGG + Intronic
1181470629 22:23137165-23137187 CCAGAGAGGCAGAGGCTGCAGGG - Intronic
1184728805 22:46362035-46362057 CCAGAGGGGAGAACCCTGCCTGG + Exonic
1185375486 22:50481182-50481204 CCACCGGGTCAGACCCTGGAGGG + Intergenic
950658426 3:14451781-14451803 CCCCAGGGTCAGACGCTGCAGGG - Intronic
951441717 3:22731320-22731342 CCAGAGGAGCAGACTTTGAAAGG + Intergenic
952386467 3:32845055-32845077 CCAGAAGGGAAGACCTGGCAAGG - Intronic
952865378 3:37851783-37851805 TCAAAGGGGCAGTCCCTCCAAGG + Intergenic
952889137 3:38029467-38029489 CGCGAGCGGGAGACCCTGCAGGG - Intronic
953418160 3:42734721-42734743 CCAGTGGGCCAGAGGCTGCAAGG + Intronic
953905090 3:46864684-46864706 GCACTGGGGCAGACCCTGCTTGG - Intronic
954643845 3:52118634-52118656 CCAGAGGGGCAGACCCTGCATGG - Intronic
954670779 3:52290353-52290375 CAAGCGGGGCAGGACCTGCAGGG - Exonic
954716597 3:52529913-52529935 CCAGAGGGGCTGGCTCTGTATGG + Intronic
955376255 3:58399781-58399803 CCTGGAGGGCAGACCCTTCAAGG - Intronic
955409894 3:58648766-58648788 CAGGAGGGGCACCCCCTGCAAGG - Intronic
956651177 3:71505965-71505987 CCAGAGAGGCAGACTGTGCCTGG - Intronic
959582336 3:107994258-107994280 CCAGAGGGCCAGATCTTACAGGG - Intergenic
961324629 3:126102925-126102947 CCAGAGGGGCAGAGCCAGGTGGG + Intergenic
962601274 3:136992428-136992450 TCAGAGGGTCAGACCTTGGAAGG + Intronic
962975441 3:140442138-140442160 CGAGAGGGACAGTCCCTCCAGGG - Intronic
967767969 3:193303103-193303125 CCAGATGTGGAGACCTTGCAGGG - Intronic
967893737 3:194381592-194381614 CCGCAGAGGCAGACCCTCCAGGG - Intergenic
968573548 4:1354655-1354677 CCGGAGAGGCAGACCATGCAAGG - Intronic
968664968 4:1816046-1816068 CCAGAGGGGCAGCCACTGAGGGG - Intronic
968873884 4:3255087-3255109 GCAGAGGGGCATATCCTGCCAGG - Intronic
968916508 4:3499201-3499223 TCAGGGAGGCCGACCCTGCAGGG + Intronic
969233040 4:5845211-5845233 CCAGGGGAGGGGACCCTGCAGGG - Intronic
969285899 4:6201505-6201527 ACAGAGGGGCAGCACTTGCAAGG + Intergenic
969498181 4:7538097-7538119 ACAGAGAGGCAGACCTGGCAAGG - Intronic
969586748 4:8098203-8098225 CCAGAGGGGCTGGGGCTGCAGGG - Intronic
970530567 4:16978089-16978111 CCAGAGGGGCAGAGCATGAGAGG - Intergenic
970555278 4:17225559-17225581 CCAGTGGGTCTTACCCTGCAAGG + Intergenic
971599998 4:28580654-28580676 CAAGAATGGCAGACCCTGCAGGG + Intergenic
971904523 4:32709858-32709880 CCTGAGGGGCTGACCCTCCAGGG - Intergenic
974016767 4:56655700-56655722 CCAGGGGCCCAGACCCTGCATGG - Intronic
976171027 4:82304563-82304585 CCCGGGGGGCGGAGCCTGCAGGG - Intergenic
976441247 4:85077477-85077499 CCAGAGGGGGAAAGCCTTCAGGG - Intergenic
976958862 4:90942021-90942043 CCCGAGAGGCAGACGTTGCAGGG - Intronic
977359025 4:95980871-95980893 CCAGAGGGGCTGAGGCAGCAGGG - Intergenic
978323230 4:107521568-107521590 CCACAAGGGCAGAGCCTGTATGG - Intergenic
980604233 4:135068146-135068168 CCAGAGGTTCAGAGCCTGCAAGG - Intergenic
982337584 4:154257609-154257631 ACAGAGGGTCAGACCCTCAAAGG + Intronic
983051010 4:163047835-163047857 CCAGAGGCTGAGAGCCTGCAAGG - Intergenic
983081141 4:163386944-163386966 CCAGAGAAGCAGAACCTGTAGGG + Intergenic
983960880 4:173752619-173752641 TCAGAGGTGCAGTCCCTGCCAGG - Intergenic
985107836 4:186516133-186516155 CCAGAGGCTCAGACCCTTCAGGG + Intronic
985774457 5:1833650-1833672 GCACAGAGGCAGACCCTGCAAGG + Intergenic
985934065 5:3080905-3080927 CCAGAGAGCCAGAACCTACAGGG + Intergenic
986477738 5:8152972-8152994 CCAGAGGAACAGACCAGGCACGG + Intergenic
989382356 5:40821987-40822009 CATGAGGGGCAGACCCCTCATGG - Intergenic
990296623 5:54407838-54407860 CCCGGGGGGCAGAGCTTGCAGGG + Intergenic
992653179 5:78882029-78882051 CCAGAGAGACAGACCTTGCTGGG - Intronic
994488350 5:100408536-100408558 TCAGAGAGGCAGGCCCGGCATGG - Intergenic
997592018 5:135079914-135079936 CCCATGGGGCAGATCCTGCAGGG + Intronic
997751473 5:136350342-136350364 GCAGAGGGGCAGGCCCTGGAGGG - Intronic
998369082 5:141649732-141649754 GCAGAGGAGCTGACCCAGCAAGG - Intronic
999744825 5:154584138-154584160 CCTGAGGGGCAGGCTCAGCAGGG - Intergenic
1001603614 5:172944847-172944869 CTGGAGGGGGAGACCCTGGATGG - Intronic
1002974430 6:2060216-2060238 GCAGAGGGGCAGAGAATGCAGGG - Intronic
1006412338 6:33881584-33881606 CCAGAGGGGCAGGCTCTGCAGGG - Intergenic
1006725459 6:36196688-36196710 CCGGAGGGGCGGATCCTGCCTGG + Intergenic
1006995557 6:38256731-38256753 CCAGTGGGGCAGAGCCTGCCTGG - Intronic
1011942231 6:92857127-92857149 CCACAGGGGCAGAGCTTTCAAGG - Intergenic
1012530590 6:100230893-100230915 CCAGAGGACCAGTCCCTCCAAGG + Intergenic
1013353253 6:109324924-109324946 GAAGGGGGGCAGACCATGCAAGG + Intergenic
1013354736 6:109336774-109336796 ACAAAGGGGCTGGCCCTGCAGGG + Intergenic
1013607231 6:111761660-111761682 CCAGAAGGGCAGAGCCTTCCGGG + Intronic
1016650611 6:146455613-146455635 CAAGAGTGTCAGACCATGCAGGG - Intergenic
1017963209 6:159240019-159240041 GCAGGGTGGCAGAGCCTGCAGGG + Intronic
1018319762 6:162595096-162595118 CCTGAGAGGCAGAGCTTGCAGGG + Intronic
1018355501 6:163010897-163010919 TCAGTGGGGCAGGCACTGCAGGG + Intronic
1018945541 6:168345323-168345345 CCACTGGGGCAGTCCCTGCAGGG + Intergenic
1019532729 7:1511718-1511740 ACAGGCGGGCAGACCCAGCAGGG - Intergenic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1020834542 7:13132423-13132445 TCATAGGGGCAGATCCTTCATGG + Intergenic
1021115041 7:16737981-16738003 ACAGAGGGGCAGGCCAGGCATGG - Intergenic
1023159478 7:37283625-37283647 ACAGTGGGGCAGCCCCAGCAAGG + Intronic
1024471584 7:49772828-49772850 CCAGAGCGCCTGACCTTGCAGGG + Intergenic
1024629822 7:51237987-51238009 CCTGAGGGGCATGCCCTGGAGGG - Intronic
1025063068 7:55827645-55827667 CCAGAGGGGAAGACACAGCTGGG - Intronic
1028628212 7:92901856-92901878 CCAGAGAAGCAGAACCAGCAGGG + Intergenic
1031025714 7:116677436-116677458 GCAGAGGGGCAGTCACTGCTTGG + Intronic
1034891265 7:154841299-154841321 GCAGAGGGGCAAAGCCTGCTTGG - Intronic
1035580563 8:737345-737367 CCAGAAAGGCTGACCCTGCCCGG + Intronic
1035682016 8:1495212-1495234 CCACAGGTTCAGACCCAGCACGG - Intergenic
1037288924 8:17330336-17330358 CCAGAAGCGCAGACAGTGCATGG + Intronic
1037316154 8:17601322-17601344 CCAGAGGCACTGAGCCTGCAGGG + Intronic
1037344487 8:17884265-17884287 CCAGAGAGGCAGAGGTTGCAGGG - Intronic
1037589875 8:20303687-20303709 CCAGGGCAGCAGACCCTCCAGGG + Intronic
1037950508 8:23016257-23016279 AAAGAGTGGCAGACCCTTCAGGG - Intronic
1041911001 8:63087893-63087915 CAAGAGGGGCTGACTGTGCAAGG + Intergenic
1043172167 8:76979272-76979294 CCAGAGAGGCAGAGACTGAATGG + Intergenic
1047415476 8:124661586-124661608 CCAAAGGTGCAGACACTGCTGGG + Intronic
1049310278 8:141930519-141930541 CCAGAGGGGCAGAACCACCCTGG - Intergenic
1049372622 8:142274968-142274990 GCAGAGGAGCAGAGGCTGCAGGG + Intronic
1051585959 9:18727208-18727230 TCAGAGAGGAAGAGCCTGCAAGG - Intronic
1052522232 9:29562994-29563016 CCACAGGGGCAGAGCCATCATGG + Intergenic
1054605107 9:67168539-67168561 TCAGAGGGGAAGGCTCTGCATGG + Intergenic
1057438461 9:95063817-95063839 CATGAGGGCCAGACCCTGAAGGG - Intronic
1057859539 9:98628888-98628910 CCAGAGCTGCAGCCCCTGTAGGG - Intronic
1059384501 9:113953814-113953836 CCAGAGGCACAGCCCCTGCCTGG + Intronic
1061134247 9:128724128-128724150 CCAGAGGGGCGGGCCCTCCGAGG + Intergenic
1061862687 9:133476049-133476071 CTAGAGGGGCAGGCCCTGCCTGG + Intronic
1062077089 9:134595302-134595324 CCCGGGGGGCAGACCGTGCGGGG + Intergenic
1062210438 9:135360635-135360657 CCGGAGGAGCAGCCCCTGCTGGG + Intergenic
1062512941 9:136917418-136917440 ACAGAGGGGCAGAGTCTGCAGGG - Intronic
1062635345 9:137487687-137487709 CCAGAGGAGCAGAGGCTGCCAGG - Intronic
1189755213 X:44264401-44264423 CTGGTGGGGCAGGCCCTGCAGGG - Intronic
1190918512 X:54827538-54827560 CCAGAAGGGAAGATCCTTCAAGG + Intergenic
1193214536 X:78847915-78847937 ACAGAGGGGCAAATACTGCATGG - Intergenic
1193443930 X:81577093-81577115 CCAAACTGGCAGGCCCTGCATGG - Intergenic
1193468897 X:81876120-81876142 ACAGAGGTGCCCACCCTGCAGGG - Intergenic
1193696145 X:84709206-84709228 CCAGAAGAGCAGGCCCTGCAAGG + Intergenic
1194571470 X:95559150-95559172 CCAGAAGGACAGACCCTCTAGGG - Intergenic
1194827336 X:98578992-98579014 CCAGAGGAGCAGATCCTGCTAGG + Intergenic
1195020225 X:100819685-100819707 CCGGAAAGGCAGACCCTGCCGGG - Intergenic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1197984851 X:132256531-132256553 CTGATGGGGCAGACCCTGCATGG - Intergenic
1199525273 X:148784878-148784900 CGAGAGGGGCAGCCCGTGCATGG - Intronic
1199871468 X:151902277-151902299 CCAGTGGCACTGACCCTGCAGGG + Intergenic
1199878104 X:151950985-151951007 CCAGAGGCTCAGAACCTCCAGGG + Intergenic
1200056659 X:153465041-153465063 AGTGAGGGCCAGACCCTGCAGGG + Exonic
1200157040 X:153982355-153982377 CCACAGGCGCAGCCACTGCACGG - Exonic
1200361666 X:155612978-155613000 CCAGAGGCACCCACCCTGCACGG - Intronic