ID: 954643850

View in Genome Browser
Species Human (GRCh38)
Location 3:52118653-52118675
Sequence CTGGCTTTCGACTGCTACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954643845_954643850 -4 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954643850 Original CRISPR CTGGCTTTCGACTGCTACGC TGG Intronic