ID: 954643850

View in Genome Browser
Species Human (GRCh38)
Location 3:52118653-52118675
Sequence CTGGCTTTCGACTGCTACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954643845_954643850 -4 Left 954643845 3:52118634-52118656 CCATGCAGGGTCTGCCCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 297
Right 954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954643850 Original CRISPR CTGGCTTTCGACTGCTACGC TGG Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
906668976 1:47641201-47641223 CTGGCTTTGGACTGCTGGGGGGG + Intergenic
917928405 1:179807456-179807478 CTGGCTTTCTCCTGCTCCACTGG - Intronic
1063697798 10:8354133-8354155 CTGGGTTTCCACTGTTAAGCAGG + Intergenic
1064224184 10:13468186-13468208 CTGCCTTTAGACTGCTTAGCAGG - Intronic
1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG + Intergenic
1073097103 10:100986686-100986708 CAGGCTTTGGACTGTTACTCCGG - Intronic
1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG + Exonic
1085884444 11:80505842-80505864 CCGACTTGAGACTGCTACGCTGG - Intergenic
1117880641 14:60310060-60310082 CTGCCTTTGAACTGCTACTCTGG - Intergenic
1119931514 14:78551986-78552008 CTGGCTTTCAAATGCTGCCCAGG - Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG + Intergenic
1135094790 16:19555908-19555930 CTGGCTTCAGATTGCTCCGCTGG - Intronic
1136735909 16:32467531-32467553 CTGGCTTTCGGCTGGTACTAGGG + Intergenic
1203017166 16_KI270728v1_random:362043-362065 CTGGCTTTCGGCTGGTACTAGGG - Intergenic
1203035501 16_KI270728v1_random:635201-635223 CTGGCTTTCGGCTGGTACTAGGG - Intergenic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG + Intergenic
1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG + Intronic
1155515381 18:26619580-26619602 CTGGCTGTCGACAGCTATTCAGG + Intronic
1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG + Intergenic
1178737452 21:35165903-35165925 CTGGCTTGCAACTCCTACTCTGG + Intronic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
950454306 3:13083606-13083628 CAGGCTTCTGACTGCAACGCAGG - Intergenic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG + Intergenic
970817878 4:20179209-20179231 CTGGCTCTCGGGTGCTGCGCTGG - Intergenic
973260684 4:48160386-48160408 CTGTCTCTGGACTGCTGCGCTGG - Intronic
977635603 4:99294155-99294177 CTGGCTTTGGACTGGTACTGGGG - Intergenic
979043678 4:115834524-115834546 CTGACTTCAGACTGCTGCGCTGG - Intergenic
983999102 4:174218483-174218505 CTGTCTTCCGACTGCCAGGCTGG - Intergenic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
999367630 5:151033442-151033464 CTGGCTCTGGGCTGCTACCCAGG - Intronic
1008129953 6:47709925-47709947 CTGGCTTAGGAATGCTAGGCAGG - Intronic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1029344285 7:99967202-99967224 CTGGCCTACGACTTCTACCCAGG - Exonic
1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG + Intergenic
1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG + Intronic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG + Intronic
1045957804 8:107929412-107929434 CTGGCTTTCAGCTGCTAAACAGG - Intronic
1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG + Intergenic
1056931538 9:90881905-90881927 CTGCCTGACGACTGCTCCGCAGG + Intronic
1062093044 9:134688601-134688623 GTGGCTTTCGGCTGCCAAGCAGG - Intronic
1187049904 X:15685564-15685586 CTGGCTTTCAACAACTACGGTGG - Intergenic
1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG + Intronic
1191626472 X:63276148-63276170 CTGGCTTTTGACAGCTAAGGTGG - Intergenic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic