ID: 954644377

View in Genome Browser
Species Human (GRCh38)
Location 3:52122015-52122037
Sequence CCCAAACGTGGGGCTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954644377_954644391 25 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644391 3:52122063-52122085 GACGGGTCCCTTGTCTCCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 61
954644377_954644387 7 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644387 3:52122045-52122067 ACCCAGGGTTCAGTATGGGACGG 0: 1
1: 0
2: 0
3: 16
4: 166
954644377_954644385 2 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644385 3:52122040-52122062 CTGTGACCCAGGGTTCAGTATGG 0: 1
1: 0
2: 2
3: 41
4: 690
954644377_954644386 3 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644386 3:52122041-52122063 TGTGACCCAGGGTTCAGTATGGG 0: 1
1: 0
2: 0
3: 18
4: 174
954644377_954644383 -8 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644383 3:52122030-52122052 CGTTTGGGTCCTGTGACCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 100
954644377_954644382 -9 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644382 3:52122029-52122051 ACGTTTGGGTCCTGTGACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 120
954644377_954644389 8 Left 954644377 3:52122015-52122037 CCTCTAGGAGCCCCACGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954644389 3:52122046-52122068 CCCAGGGTTCAGTATGGGACGGG 0: 1
1: 0
2: 0
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954644377 Original CRISPR CCCAAACGTGGGGCTCCTAG AGG (reversed) Intronic