ID: 954645538

View in Genome Browser
Species Human (GRCh38)
Location 3:52129435-52129457
Sequence CAGGGTATCCACTTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954645530_954645538 25 Left 954645530 3:52129387-52129409 CCTCATGATGGCTTATTCCTTTT 0: 1
1: 0
2: 2
3: 16
4: 256
Right 954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 172
954645529_954645538 26 Left 954645529 3:52129386-52129408 CCCTCATGATGGCTTATTCCTTT 0: 1
1: 0
2: 4
3: 25
4: 337
Right 954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 172
954645531_954645538 8 Left 954645531 3:52129404-52129426 CCTTTTATTTAATCAATCACTCT 0: 1
1: 0
2: 3
3: 59
4: 653
Right 954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954645538 Original CRISPR CAGGGTATCCACTTGGGGCA GGG Intronic
907410457 1:54279908-54279930 TAGGGTCTCAGCTTGGGGCAAGG - Intronic
910840415 1:91555841-91555863 CAGGGTATCCCTGTGAGGCAAGG + Intergenic
911286570 1:96001570-96001592 CAAGCTGTCTACTTGGGGCAGGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
917045612 1:170856679-170856701 CAGGGTATTCATTTTTGGCAAGG - Intergenic
919694907 1:200564367-200564389 CAGGGGCTACACTTTGGGCATGG + Intronic
920303448 1:205003635-205003657 TAGGATATCCCCTGGGGGCAAGG - Intronic
920340585 1:205272917-205272939 CAGGGAAGACACTGGGGGCACGG - Exonic
921909283 1:220528982-220529004 CAGGGTCTCCACCTGGAGCCCGG + Intronic
1063445923 10:6117004-6117026 CATGGTTTCCACTTGAGGAATGG - Exonic
1064956875 10:20921324-20921346 CAGGGTCTCCTCCTGGGACATGG - Intronic
1070170959 10:73932399-73932421 GAGGTTAGCCACTTGGGGTAAGG - Intergenic
1070517287 10:77219974-77219996 CAAGGTCTCCACTTGTGGAATGG - Intronic
1070691887 10:78533153-78533175 CCGGGATTCCACTTGGAGCATGG + Intergenic
1071033421 10:81212918-81212940 CAGTCTATTCACTTGGGGCATGG + Intergenic
1072721143 10:97781773-97781795 CAGGCTATCCACTGGGGGAGAGG - Intergenic
1073996581 10:109322664-109322686 CGTGGTTTCCACATGGGGCAAGG + Intergenic
1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG + Intronic
1075434004 10:122418282-122418304 AAGGGCATCCACATGGGGAAGGG + Intronic
1081341495 11:41933487-41933509 CGGGGTGTCCACATGCGGCAGGG - Intergenic
1081983980 11:47288419-47288441 CAGGGAATCCACATGTGGCCGGG + Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084033419 11:66494011-66494033 CAGGACAGACACTTGGGGCAGGG + Intronic
1084653039 11:70500149-70500171 CAGGGCAGCCTCTTGGGGAATGG + Intronic
1089527051 11:119103942-119103964 CAGGGTGTCCCCATGGGGCTAGG + Intronic
1090420076 11:126568566-126568588 CAGGGAGGCCACATGGGGCAGGG + Intronic
1094485845 12:30925892-30925914 CAGGGAAGCCACTGGAGGCAGGG - Intergenic
1100953803 12:99883598-99883620 CAAGGCATAGACTTGGGGCAGGG + Intronic
1101490797 12:105207652-105207674 CAGAGTCAACACTTGGGGCAAGG + Intronic
1105751081 13:23421761-23421783 CAGGGTATCTACCTGGAGCGTGG + Intronic
1106518503 13:30475894-30475916 CAGGCTAACCACTTAGGGAATGG - Intronic
1106675398 13:31952927-31952949 CGGGGGCTCCACTTGGCGCATGG - Intergenic
1108679089 13:52763912-52763934 CAGGGGCTCCTCCTGGGGCATGG + Intergenic
1113146082 13:107209055-107209077 CAGCATATCCACATGGGGGAGGG + Intronic
1114032349 14:18588171-18588193 CCTGGTATCCACCTGGGGCCTGG - Intergenic
1114032599 14:18589354-18589376 CTGGATATCAACTTGGGGCCTGG - Intergenic
1114077130 14:19167197-19167219 CCTGGTATCCACCTGGGGCCTGG - Intergenic
1114085034 14:19232367-19232389 CCTGGTATCCACCTGGGGCCTGG + Intergenic
1120746255 14:88154584-88154606 CAGGGTAGACACATGGGGCGGGG + Intergenic
1121147817 14:91600822-91600844 CAGGGCAGCCCCTTGGGGCAAGG - Intronic
1122920531 14:104878148-104878170 CAGGGTGTCCACGGGGGGCCGGG - Intronic
1202896290 14_GL000194v1_random:12633-12655 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1202896611 14_GL000194v1_random:14076-14098 CCTGGTATCCACTTGGGGCCTGG + Intergenic
1202897182 14_GL000194v1_random:16944-16966 CCTGGTATTCACTTGGGGCCTGG - Intergenic
1125505226 15:40264032-40264054 CAGGCTATCCTCTTGGCTCAGGG + Intronic
1126534223 15:49742801-49742823 CAGTGGATCCACTTGGAGCCTGG + Intergenic
1128064338 15:64755116-64755138 CAGAGTTTCCGCTTGGGGTAGGG + Intronic
1132687028 16:1166583-1166605 CAGGGTTTCCTCTCGGGGCGAGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141031088 16:80589379-80589401 CAGGCTATGCACTTTTGGCAAGG - Intergenic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1142483662 17:233496-233518 CATGGCAGCCACTAGGGGCAGGG + Intronic
1143670577 17:8393153-8393175 CAGGCTGTCCAGTGGGGGCACGG + Exonic
1143980718 17:10867283-10867305 CAGTGTATTCACATGGGGCAGGG - Intergenic
1144330998 17:14224222-14224244 GAGGGTGTCCACCTGGGGAAGGG - Intergenic
1144737406 17:17562882-17562904 CAGAGAAGCCACATGGGGCAGGG - Intronic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1152189258 17:78878654-78878676 CAGGGTAGCCACGTGGGGTTAGG + Intronic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1157574209 18:48732816-48732838 CAGGGTCTCCAATTTGTGCAAGG + Intronic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1159920663 18:74224577-74224599 CTGGGAATACACGTGGGGCATGG - Intergenic
1162914391 19:13866115-13866137 CAGGGTATTTACTGGGGCCAAGG + Intronic
1164611427 19:29635098-29635120 CAGGGACTCCACAGGGGGCAGGG - Intergenic
1165175902 19:33929547-33929569 CATGGTTTCCACCTGGGCCAGGG + Intergenic
1166763780 19:45240500-45240522 CAGGGTTTCCTTTTGGGGAAAGG + Intronic
1166903156 19:46082345-46082367 GAGGGTAGCCTTTTGGGGCAAGG + Intergenic
1167016482 19:46844267-46844289 CAGGGTAATCTCTTGGTGCAGGG - Intronic
925923913 2:8657289-8657311 CCGGGAATCCACATAGGGCAGGG + Intergenic
926262371 2:11277425-11277447 CAGTGTATACTCTTGGGGGATGG - Intronic
928175112 2:29028189-29028211 CATGGTCTCCAGTTGGGGCGAGG - Intronic
933157569 2:78992713-78992735 CAGGGTAGCCTCTTGGGGCTCGG - Intergenic
935119853 2:100175028-100175050 TAGGGTATTAACTGGGGGCATGG + Intergenic
937118419 2:119425939-119425961 CGGGGAATTCACTGGGGGCAGGG - Intergenic
937443019 2:121932960-121932982 CAGGGAACCCACTTGGAGCTAGG - Intergenic
938491730 2:131764711-131764733 CCTGGTATCCACCTGGGGCCTGG - Intronic
938495836 2:131797631-131797653 CCTGGTATCCACCTGGGGCCTGG + Intronic
939660856 2:144887727-144887749 CAAGGTATCCACCTCGGACATGG - Intergenic
940014213 2:149086525-149086547 CAGGGTGTCAACTTTGAGCAAGG + Intronic
944188086 2:196971792-196971814 CAGGCTCTCCCCATGGGGCAAGG + Intronic
948585580 2:239016772-239016794 CAGGATGTCCCCTCGGGGCAGGG + Intergenic
1168813212 20:719807-719829 CAGGGTCTCCACCTGGGCGACGG + Intergenic
1169724642 20:8715688-8715710 CAGTGTGTCCACTTGGGGAGGGG - Intronic
1171229875 20:23475668-23475690 CAGCGTACCCACTGGGGGCCAGG - Intergenic
1171933096 20:31246333-31246355 CTGGGTCTCAACTTGGGGAAGGG - Intergenic
1173248000 20:41349459-41349481 TAGGGTTTCCATTTGGGGGATGG - Intronic
1173675431 20:44830970-44830992 CAAGGTGACAACTTGGGGCAGGG + Intergenic
1173855294 20:46246591-46246613 CAGGGTTGCCAATGGGGGCAGGG + Intronic
1175984609 20:62758437-62758459 GAGGGGATCCACTCAGGGCAGGG + Intronic
1176047620 20:63100959-63100981 CAGGGTGTCCACTGGGGGACGGG + Intergenic
1176615977 21:9028629-9028651 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1176616299 21:9030072-9030094 CCTGGTATCCACTTGGGGCCTGG + Intergenic
1176616866 21:9032933-9032955 CCTGGTATTCACTTGGGGCCTGG - Intergenic
1176707915 21:10128722-10128744 CTGGATATCCACCTGGGGCTTGG + Intergenic
1176708834 21:10133558-10133580 CCAGGTATCCACCTGGGGCTCGG - Intergenic
1176709176 21:10135099-10135121 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1180085006 21:45504526-45504548 CAGGGTAGCCACGTGGGCCTGGG - Exonic
1180292936 22:10860826-10860848 CCTGGTATCCACCTGGGGCCTGG - Intergenic
1180293191 22:10862009-10862031 CTGGATATCAACTTGGGGCCTGG - Intergenic
1180456460 22:15515228-15515250 CCTGGTATCCACCTGGGGCCTGG - Intergenic
1180456712 22:15516411-15516433 CTGGATATCAACTTGGGGCCTGG - Intergenic
1180495743 22:15890248-15890270 CCTGGTATCCACCTGGGGCCTGG - Intergenic
1180940553 22:19657560-19657582 CTGGGTATCCACCTGGGACCTGG + Intergenic
1181801802 22:25352512-25352534 CACGGTAACGGCTTGGGGCAGGG + Intronic
1181928002 22:26375773-26375795 CAGGGTCTCCACCTGGAGCTCGG + Intronic
1182366808 22:29784625-29784647 CAGGGGACCCACCTGGGGGAAGG - Intergenic
1183086909 22:35492088-35492110 CAGGGAGTACACTTGAGGCAGGG - Intergenic
1183235501 22:36613989-36614011 CAGGGGAGCCACTTGGGGGTTGG - Intronic
1183251336 22:36732502-36732524 CAGGGTGTCCACTGCGTGCAAGG - Intergenic
1183408647 22:37642456-37642478 CAGGCCAGCCCCTTGGGGCAGGG - Intronic
951097185 3:18645760-18645782 CAGGGTTTCCATTTGAGGCATGG + Intergenic
954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG + Intronic
955874359 3:63474521-63474543 CAAGGTACTCACTTGGGCCAGGG - Intronic
956080326 3:65549724-65549746 CAGGGCACCCACTAGGGGAAGGG + Intronic
961269884 3:125680711-125680733 CTGGGTATTTACCTGGGGCATGG - Intergenic
968603978 4:1522844-1522866 CAGGGTGCCCACATGGGGCAGGG + Intergenic
968699001 4:2046023-2046045 CAGGGCATCCCCTTGGTCCAGGG + Intergenic
978315162 4:107427547-107427569 GAGGGCAGCCCCTTGGGGCAAGG - Intergenic
978829089 4:113061182-113061204 CATGGAAGCCACTTGGGGCAGGG - Intronic
979504823 4:121484379-121484401 CTGGGTATCCACTTTGGTTAGGG + Intergenic
980723272 4:136724140-136724162 CAGGGTATACACTAGGTACAAGG + Intergenic
982372227 4:154646910-154646932 CCTGGTAGCCACATGGGGCAAGG + Intronic
993650425 5:90514060-90514082 CAGGGCAGCCCCTTGGGGCAAGG + Exonic
1001982741 5:176047641-176047663 CCTGGTGTCAACTTGGGGCATGG + Intergenic
1002182825 5:177440392-177440414 CTGGGTATGCAGTTGGGGCGGGG - Intronic
1002234722 5:177796416-177796438 CCTGGTGTCAACTTGGGGCATGG - Intergenic
1002281084 5:178130631-178130653 AAGCGTAACCACTTGGGGCTTGG + Intergenic
1002334277 5:178467308-178467330 AAGGGTCTCCACCAGGGGCAGGG - Intronic
1002584257 5:180231919-180231941 CATGGTATCCACTGGGGTCCAGG + Intergenic
1004123019 6:12844165-12844187 CAGGATAACCACTTGAGGCCAGG + Intronic
1004148655 6:13093632-13093654 CAAGGAATTCACTTGAGGCAAGG - Intronic
1004636186 6:17470242-17470264 CAAGTTACCCACTTGGGGGAAGG + Intronic
1007126995 6:39433756-39433778 CAAGGCCACCACTTGGGGCAAGG + Intronic
1007732216 6:43954198-43954220 CTGGGTCTCCTCATGGGGCAGGG + Intergenic
1008513162 6:52296189-52296211 TCAGGTATCCACTGGGGGCATGG - Intergenic
1009628552 6:66166254-66166276 CAGTGTGTCTGCTTGGGGCAGGG + Intergenic
1009969791 6:70614528-70614550 GAAGGTATCCACTTGGGTTACGG - Intergenic
1010169150 6:72954427-72954449 CAGTGTATCCACTTAAGGAAGGG + Intronic
1010778611 6:79916807-79916829 CAGTGCATCCATTTGGGGAAGGG + Exonic
1011614922 6:89189120-89189142 CAGGGTAACTGCTTGGGGAAGGG - Intronic
1013349518 6:109292485-109292507 CAGGCCATCCACAAGGGGCAGGG + Intergenic
1015563179 6:134538191-134538213 CAGGCTATCCACATGGTGCTTGG - Intergenic
1015974299 6:138773721-138773743 CGGGGCTTCCGCTTGGGGCATGG + Exonic
1020012349 7:4813285-4813307 CAGTGTTTCCACTGGGGGCCTGG + Intronic
1023930316 7:44701318-44701340 CTGGGTATCCACTCCTGGCAGGG - Intronic
1023940395 7:44765551-44765573 CAGGGTAGTCGCTGGGGGCAGGG - Exonic
1026142828 7:67720945-67720967 CAGGGTTTAGACTTGGGACAGGG + Intergenic
1030805483 7:113912822-113912844 CAGAGGATCCATTTGAGGCATGG + Intronic
1034342360 7:150366088-150366110 CAGGGCATCCACTTGGGAGGGGG + Intergenic
1036602181 8:10271513-10271535 GTGGGAATCCACTTGAGGCATGG + Intronic
1038385631 8:27141855-27141877 TAGTGTATGCACTTGGGGAATGG - Intergenic
1040592394 8:48805581-48805603 CAGTGTGTCCTCATGGGGCAGGG - Intergenic
1040942416 8:52846376-52846398 CCAGGTCTCCACTGGGGGCAGGG - Intergenic
1047701077 8:127449927-127449949 CAGGATATACATGTGGGGCAGGG + Intergenic
1048476925 8:134751933-134751955 CAGGGAATCCACCTGGCTCATGG + Intergenic
1048942314 8:139411821-139411843 CAGGATAATCACTTGAGGCAAGG - Intergenic
1049181720 8:141226389-141226411 CAGGGAAAGCACGTGGGGCAGGG - Intronic
1051646828 9:19277039-19277061 CAAGGTAGCCATTTGGGGAAAGG - Intronic
1052603791 9:30672272-30672294 CTGAGTATCCACCTGGGGCCTGG + Intergenic
1053645810 9:40119055-40119077 CCAGGTATCCACCTGGGGCTCGG - Intergenic
1053646147 9:40120627-40120649 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1053759568 9:41342913-41342935 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1053760872 9:41349394-41349416 CTGGATATCCACCTGGGGCTTGG - Intergenic
1054326822 9:63716956-63716978 CCAGGTATCCACCTGGGGCTCGG - Intergenic
1054327160 9:63718524-63718546 CTAGGAATCCACTTGGGGCCTGG - Intergenic
1054538423 9:66255349-66255371 CTAGGAATCCACTTGGGGCCTGG + Intergenic
1054538761 9:66256917-66256939 CCAGGTATCCACCTGGGGCTCGG + Intergenic
1055199763 9:73646199-73646221 CAGGGCATGCACTGGGGGCATGG + Intergenic
1055516451 9:77038443-77038465 CTGTGTATTAACTTGGGGCAAGG + Intergenic
1055527076 9:77145780-77145802 CAGGCTTTCCACATGGGGCATGG + Intergenic
1056137207 9:83642173-83642195 CAGGATTTCCACTGGGGTCATGG - Intronic
1056956833 9:91089351-91089373 CAGGGCATCCACTTAGAGGAAGG - Intergenic
1057155706 9:92837246-92837268 CAGGGGCTCCACTTGGCGCATGG + Intergenic
1057991553 9:99776008-99776030 CAGGGTATTCTCCTGGAGCAGGG - Intergenic
1058054531 9:100436239-100436261 CAGGGTGATCACTTGGGCCAAGG - Intronic
1058383564 9:104406874-104406896 AATGGTATATACTTGGGGCAAGG - Intergenic
1060559343 9:124530035-124530057 CAGAGTGAACACTTGGGGCAAGG - Intronic
1061067282 9:128286345-128286367 CAAGCTAGCCACTTGAGGCATGG - Intronic
1061385541 9:130287264-130287286 CAGGGTAGCAAGTTTGGGCAAGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1202792660 9_KI270719v1_random:97602-97624 CTGGATATCCACCTGGGGCTTGG + Intergenic
1202793595 9_KI270719v1_random:102528-102550 CCAGGTATCCACCTGGGGCTCGG - Intergenic
1186225501 X:7395074-7395096 CAGCGTGTCCTCTTTGGGCAGGG + Intergenic
1190622558 X:52302074-52302096 CAGTGGTTCCTCTTGGGGCAAGG - Intergenic
1192013400 X:67299858-67299880 CAAGGTTCCCACTGGGGGCATGG - Intergenic
1196236186 X:113283453-113283475 CAGAGTAAACACTTGGGGCTTGG + Intergenic
1198030173 X:132747035-132747057 CGTGCTATCCACTTGGGACATGG + Intronic
1201149674 Y:11088797-11088819 CCTGGTATCCACTTGGGGCCTGG + Intergenic