ID: 954646222

View in Genome Browser
Species Human (GRCh38)
Location 3:52133203-52133225
Sequence CCTCACATGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954646222_954646226 -1 Left 954646222 3:52133203-52133225 CCTTCCACCTTCTGCATGTGAGG 0: 1
1: 0
2: 5
3: 38
4: 250
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646222_954646230 24 Left 954646222 3:52133203-52133225 CCTTCCACCTTCTGCATGTGAGG 0: 1
1: 0
2: 5
3: 38
4: 250
Right 954646230 3:52133250-52133272 GCAGCATTCAAGCCCCATCTCGG 0: 1
1: 0
2: 5
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954646222 Original CRISPR CCTCACATGCAGAAGGTGGA AGG (reversed) Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
915102892 1:153513413-153513435 CCTCTGATGCATATGGTGGAAGG + Intergenic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
915601510 1:156925492-156925514 CCTCACATCCATAAAGTGGGTGG - Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
918847843 1:189641792-189641814 CATCCCATGAAGAAGGTAGAAGG + Intergenic
921250314 1:213291253-213291275 CCTCACACAAAGAAGTTGGAAGG - Intergenic
921901317 1:220454140-220454162 CATAACATCCAAAAGGTGGAAGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
923621905 1:235586739-235586761 CCACTCATGCAGAAGGTGAAGGG - Intronic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081981184 11:47268339-47268361 ACTCACATGGGGATGGTGGATGG - Exonic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1094035651 12:26067690-26067712 CCTCACATGCAGACATTGAAAGG + Exonic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1106509785 13:30402884-30402906 CATCCCATCCAGAAGGTGGGTGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1113138300 13:107117938-107117960 CCTCAAATCCAGAAGACGGATGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1120247035 14:82019640-82019662 CCTCCCATGCACAAGGTAGCTGG + Intergenic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129540554 15:76343892-76343914 CCCCACTTGCAGATGATGGAAGG + Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134818866 16:17229315-17229337 GGTCACATGCACAAGGAGGATGG - Intronic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141802451 16:86320041-86320063 GCTCACATGCCGAAGGTGGGAGG - Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148681621 17:49477326-49477348 GCACCCATGCAGAAGATGGAAGG - Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150322705 17:64229859-64229881 CCTCACATTGAGAAGCTGAATGG - Intronic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151607097 17:75144720-75144742 CCTCAGATTCAGCAGGTTGAGGG - Intronic
1152326136 17:79638824-79638846 CCACTCATGTAGAAGGTGAAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1155812604 18:30256741-30256763 CATCACATCCAGAAGGTTAAGGG + Intergenic
1156369586 18:36460886-36460908 CCTCACTTTCAGCAGGTGAAGGG - Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930133395 2:47876430-47876452 CCTCACTTACAGAAGCTTGATGG - Intronic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931334594 2:61326752-61326774 CCTAGCATGCAGAAGGTCAATGG + Intronic
932216094 2:69966853-69966875 CCTAACATACAGAAGATGGGGGG + Intergenic
932458983 2:71870159-71870181 ACTCACATGCAGAAGATCAAGGG - Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
937232298 2:120405278-120405300 CCTCACACGCAGTAGGTGCCTGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938131995 2:128724701-128724723 CCGAACATGCAGATGATGGATGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
941017192 2:160370606-160370628 CCACACATTTAGAAGGTGGCAGG + Intronic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG + Intronic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1171317236 20:24205956-24205978 CCCCACAAGCAGGTGGTGGAAGG + Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1174884012 20:54311816-54311838 CCTCACATTCAGGAGGCAGAAGG + Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176718517 21:10374610-10374632 CCTTACATGGTAAAGGTGGAAGG - Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179174125 21:38995171-38995193 CCTCACATACAAAAGGTGCTTGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1185090962 22:48772925-48772947 CACCACGTTCAGAAGGTGGAAGG - Intronic
1185273316 22:49938433-49938455 CCAGACATGGAGAAGGCGGATGG + Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
958812259 3:98874781-98874803 CCTCACATGACGAGGTTGGAGGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG + Intronic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
970124076 4:12789786-12789808 CCACACATCAAGAAGGTGGCTGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
987113683 5:14710639-14710661 CCACACATGCAGGAGGCGGGTGG - Exonic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1002434032 5:179220461-179220483 CCTCACACTCAGAAGGTCCAGGG + Intronic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1012391367 6:98744475-98744497 CCTAACAGTCAGAAGGTGGCTGG - Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1015208806 6:130672199-130672221 CCTCCCACGTTGAAGGTGGATGG - Intergenic
1016662368 6:146596446-146596468 CCTGACATGGAGCAGGTGGTAGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019545039 7:1570074-1570096 CCTGACTTCCGGAAGGTGGACGG - Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024866764 7:53912095-53912117 ACACACATGGAGAAGGTGGTGGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1027231364 7:76274554-76274576 GCTCAAATTCAGAAGATGGAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1031154629 7:118095239-118095261 CCTCACATCCAGAACCTAGAAGG + Intergenic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038093326 8:24279189-24279211 CCCCACATGCATTAGGTAGATGG - Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1049940859 9:544941-544963 CCTCACATACCCAAGCTGGAGGG - Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1056262519 9:84862946-84862968 CCTCACATCTGGAAGGTGGTTGG + Intronic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057024581 9:91725394-91725416 CCACACATGCACAAGTGGGAAGG - Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1060929335 9:127479109-127479131 CCTCACATGCCTCAGGTGGGTGG + Intronic
1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG + Exonic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200039692 X:153356060-153356082 CCCCACCTGAGGAAGGTGGAGGG + Intronic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic