ID: 954646226

View in Genome Browser
Species Human (GRCh38)
Location 3:52133225-52133247
Sequence GACAGTGTTACTCCCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954646221_954646226 0 Left 954646221 3:52133202-52133224 CCCTTCCACCTTCTGCATGTGAG 0: 1
1: 0
2: 3
3: 29
4: 343
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646220_954646226 3 Left 954646220 3:52133199-52133221 CCGCCCTTCCACCTTCTGCATGT 0: 1
1: 0
2: 5
3: 51
4: 594
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646225_954646226 -8 Left 954646225 3:52133210-52133232 CCTTCTGCATGTGAGGACAGTGT 0: 1
1: 0
2: 3
3: 20
4: 228
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646222_954646226 -1 Left 954646222 3:52133203-52133225 CCTTCCACCTTCTGCATGTGAGG 0: 1
1: 0
2: 5
3: 38
4: 250
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646219_954646226 8 Left 954646219 3:52133194-52133216 CCTTTCCGCCCTTCCACCTTCTG 0: 1
1: 2
2: 10
3: 129
4: 866
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110
954646224_954646226 -5 Left 954646224 3:52133207-52133229 CCACCTTCTGCATGTGAGGACAG 0: 1
1: 0
2: 2
3: 32
4: 342
Right 954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954646226 Original CRISPR GACAGTGTTACTCCCCTCAG AGG Intronic
901168653 1:7237822-7237844 CTCATTGTTACTCCCCACAGGGG + Intronic
903884146 1:26531294-26531316 GGCAGTGTTCCTCACCTCAGAGG - Intronic
904604461 1:31691224-31691246 GACTCTGTTTCTGCCCTCAGGGG - Exonic
905312375 1:37058830-37058852 GACCAGGTTTCTCCCCTCAGGGG - Intergenic
905626698 1:39494106-39494128 GCCTGTGCTGCTCCCCTCAGAGG + Intronic
905670195 1:39786350-39786372 GCCTGTGCTGCTCCCCTCAGAGG - Intronic
905845962 1:41232166-41232188 GATAGGGTTTCTTCCCTCAGTGG - Intronic
905915354 1:41680538-41680560 GACAATGTTCCTGCCCTGAGTGG - Intronic
909856434 1:80539073-80539095 TAGAATGTTGCTCCCCTCAGGGG + Intergenic
911404328 1:97417835-97417857 GACAGTGTTACTGGTGTCAGTGG - Intronic
912448649 1:109756575-109756597 GACAGAGATACTCCCTGCAGGGG - Intronic
913683117 1:121206087-121206109 GGCAGTGTGTCTTCCCTCAGTGG + Intronic
914034958 1:143993712-143993734 GGCAGTGTGTCTTCCCTCAGTGG + Intergenic
914154496 1:145074259-145074281 GGCAGTGTGTCTTCCCTCAGTGG - Intronic
917547734 1:175989339-175989361 GTGAGTATTACTCTCCTCAGAGG - Intronic
919582539 1:199394460-199394482 GACAGTTTTACTACAATCAGGGG + Intergenic
920470426 1:206224597-206224619 GGCAGTGTGTCTTCCCTCAGTGG + Intronic
1062765212 10:57308-57330 GACAGTGATCCTCTCCTCACAGG + Intergenic
1063052564 10:2468620-2468642 GACAGGGATGCTCCCCTAAGGGG - Intergenic
1063494161 10:6491371-6491393 GACAGTGTTTCTCCTCTCACTGG - Intronic
1069557914 10:69409511-69409533 GAAAGTGAAACTCCCATCAGGGG - Intronic
1072236901 10:93461367-93461389 GACATGGTTCCTGCCCTCAGGGG + Intronic
1072825455 10:98601653-98601675 GCCAGTATTCCTCCCCGCAGGGG - Intronic
1072903017 10:99426257-99426279 GACTGTGTGACTCCCCTAAAAGG - Intronic
1072903689 10:99431196-99431218 GACAGGTATACTTCCCTCAGGGG - Intergenic
1075614793 10:123883182-123883204 GACAGTGTGACTCCCCTGGCAGG + Intronic
1078642193 11:13107184-13107206 GACATTGTTCCTGCCCTCAAGGG + Intergenic
1079645888 11:22863572-22863594 GGCAGTGTTCCCCTCCTCAGAGG - Intergenic
1079819150 11:25103488-25103510 AACAGTGCTCCTCCTCTCAGAGG + Intergenic
1080652385 11:34233036-34233058 GACAGGGTGTCTCCCTTCAGTGG - Intronic
1083277065 11:61602896-61602918 GACAGTGTTTTTCCCATCTGAGG - Intergenic
1087277362 11:96173979-96174001 CACCGTTTTACTCCACTCAGTGG - Intronic
1097178153 12:57155411-57155433 GACAGGGTTTCTGCCCTCAAGGG + Intronic
1102532555 12:113557505-113557527 GACATTGTTCCTTGCCTCAGGGG + Intergenic
1103163373 12:118749682-118749704 GACAGTGTTTCTCTCCAGAGCGG + Intergenic
1106837528 13:33650862-33650884 CACAGTGTCAATCCCCTCTGGGG + Intergenic
1107751978 13:43577514-43577536 CACAGTGTTCTTCCCCTTAGGGG - Intronic
1110072700 13:71197094-71197116 CACAGCATTCCTCCCCTCAGAGG - Intergenic
1110537426 13:76667761-76667783 AACAGTGTTTCTACTCTCAGTGG + Intergenic
1113219133 13:108078635-108078657 GTCAGTGATGCTCCCCACAGCGG - Intergenic
1113792693 13:113037765-113037787 AACAGTGTTCCTGACCTCAGCGG - Intronic
1114669401 14:24400757-24400779 GAAAGTGTGAGTCCCCTAAGAGG - Intronic
1118147670 14:63157750-63157772 CCCAGTGGTACTCCCCTCTGTGG + Intergenic
1118707139 14:68490913-68490935 GACAGTGTAAGGCCCCTCTGAGG - Intronic
1123007679 14:105332291-105332313 CACAGTGGTCCTCCCCTCTGTGG + Intronic
1127241599 15:57121612-57121634 TACAGTATTGCTCCCCTCAGAGG + Intronic
1127598475 15:60511401-60511423 GTCTGCCTTACTCCCCTCAGGGG + Exonic
1129891946 15:79077335-79077357 GACAATATTACTCACCTCATGGG + Intronic
1131052177 15:89355979-89356001 GACAGCATTCCTCCCCTCAATGG + Intergenic
1134002550 16:10794046-10794068 GACAGTGTTCCTCCCCTCCTGGG - Intronic
1139022325 16:62765137-62765159 GACATTGTTTTTCCACTCAGGGG - Intergenic
1140073027 16:71669464-71669486 GACAGTGTTCCTGCCCTCAAGGG - Intronic
1144338184 17:14290893-14290915 CACTGTGTTCCTCCCATCAGGGG - Intergenic
1146642687 17:34553097-34553119 GACAGTGTTACCCACCTCCCAGG - Intergenic
1152272230 17:79331405-79331427 GACAGTGATGCACCCCCCAGAGG - Intronic
1154940238 18:21105592-21105614 GACAGTGTTAGTCCACACATTGG - Intronic
1163650905 19:18517129-18517151 GACAGTGTTACTCACCTGCTTGG - Intronic
1168163473 19:54528918-54528940 GAAAGTGTCTCTCCCCTCACAGG + Intergenic
1168213220 19:54906673-54906695 GACTTTGTTAATCCGCTCAGGGG - Exonic
928609523 2:32977684-32977706 GAAAGTGTGAATCCCCTGAGGGG + Intronic
930629714 2:53738986-53739008 AGCAGTGTTCCTACCCTCAGAGG - Intronic
937289701 2:120774849-120774871 GACAGTGTGTCACCCCTCAGAGG - Intronic
939654834 2:144811180-144811202 GGCAGTGTTTTTCCCCTCACAGG + Intergenic
941009928 2:160287629-160287651 GACAATGTTACTGCCCCCATGGG - Intronic
941985572 2:171507651-171507673 GACAGTGTTAGTCTCTTAAGAGG - Intergenic
948249782 2:236517369-236517391 GACAGTTCTACTTCCCTCAGAGG + Intergenic
948562557 2:238864352-238864374 GCCAGGGTTAGTCCCCTCCGCGG + Intronic
1168927190 20:1591732-1591754 GACAGTTTTACTCTCTTAAGAGG - Intronic
1170927986 20:20743233-20743255 GACTGTTTTTCTCCCCTCAAAGG - Intergenic
1171335820 20:24384575-24384597 GACAGGGGACCTCCCCTCAGGGG + Intergenic
1172401109 20:34652177-34652199 GACTCTGTTTCTCCCCCCAGGGG - Intronic
1174080077 20:47964638-47964660 GACAGTGTCACTTACCTGAGAGG - Intergenic
1175573576 20:60042550-60042572 GACAGTGTTCCTCACCTCCTGGG - Intergenic
1181545181 22:23598461-23598483 GGCAGTTTGACTCCCTTCAGTGG - Intergenic
1183407391 22:37637084-37637106 GACAGTGATACCACCCTCACTGG + Intronic
949605484 3:5648157-5648179 GTCAGTAATAGTCCCCTCAGAGG + Intergenic
949751001 3:7352796-7352818 CACAAAGTTAATCCCCTCAGAGG - Intronic
953485888 3:43295368-43295390 GACATTCCTAGTCCCCTCAGCGG + Intronic
953544885 3:43857079-43857101 GACACTTTTCCTACCCTCAGTGG + Intergenic
954646226 3:52133225-52133247 GACAGTGTTACTCCCCTCAGAGG + Intronic
963740433 3:149074671-149074693 GAATGAGTTACTACCCTCAGTGG - Intronic
963967179 3:151385935-151385957 GACAGAGTTCCTACCCTCAAGGG + Intronic
969910815 4:10444003-10444025 GCCAGTGTTAATCCCCAAAGGGG - Exonic
973856911 4:55020640-55020662 GACAGTGTTGTTCACCTCAAAGG - Intergenic
974238595 4:59213127-59213149 GACAGTGTTAGCCCACTGAGTGG + Intergenic
974831799 4:67198671-67198693 GACAGTTTTACTGCCCCAAGAGG - Intergenic
975715893 4:77205534-77205556 GATAGTGGTACTCCTCTCCGTGG - Intronic
976843796 4:89463552-89463574 GACAGCATTAATCCACTCAGAGG - Intergenic
984132406 4:175894445-175894467 GATAGAGTGACTCCCCTCTGAGG + Intronic
992363057 5:76062379-76062401 GACAATGTTCCTCCCTCCAGAGG + Intergenic
995184421 5:109256676-109256698 GACAGTATTACTAACCTCACTGG - Intergenic
995584046 5:113628542-113628564 CACAGTGGTACTCTCCTCTGTGG + Intergenic
1001673196 5:173491367-173491389 GAAATGGTTTCTCCCCTCAGTGG + Intergenic
1002403122 5:179004245-179004267 GACATTGTTACTGACCTTAGAGG + Intergenic
1003734519 6:8863609-8863631 AATAGTGTTACTTCCCTCATAGG - Intergenic
1007776894 6:44228936-44228958 GACTGTGTTACTCCCCAGAGAGG - Intronic
1007932899 6:45708488-45708510 GACAGAGTTCCTGCCCTCACAGG + Intergenic
1010269078 6:73900999-73901021 GAGAGTGGTACTGCCTTCAGTGG - Intergenic
1018518699 6:164618008-164618030 CACAGTGTTCCTCCCTTCAGAGG + Intergenic
1018641354 6:165907300-165907322 AACAGTGTTACCCACCTCTGGGG - Intronic
1022859935 7:34357316-34357338 GAAAGCGTTACTCATCTCAGAGG + Intergenic
1023606785 7:41938556-41938578 CACAGTGTTTCTCCCTTCAGAGG - Intergenic
1031588927 7:123566300-123566322 GACAGTGTTAGTTCCTTCTGAGG - Intergenic
1035179870 7:157081581-157081603 GACAATGTTGCTTACCTCAGAGG + Intergenic
1035591189 8:815272-815294 CACAGTGCTCCTCCCTTCAGAGG - Intergenic
1040649895 8:49435533-49435555 CACAGTGTTACTGCTCTTAGAGG - Intergenic
1046188207 8:110751135-110751157 GACAGTGTAACTCACTTCACTGG - Intergenic
1046770871 8:118114829-118114851 AACAGTGCTCCTCCTCTCAGGGG - Intergenic
1054758113 9:68979547-68979569 CACAGAGTCACTCCCCTCAAAGG + Intronic
1057057794 9:91977333-91977355 CACAGTGCTCCTCCCCTCTGGGG + Intergenic
1058153724 9:101488494-101488516 GACAGTGATATTTCCCTCATAGG + Intronic
1060813770 9:126624328-126624350 GCCAGTCTTACTCCCTCCAGCGG - Intronic
1061681602 9:132245182-132245204 GACAGAGTGACTGCCCACAGAGG - Intergenic
1061881109 9:133569524-133569546 GACAGTTTTTGTCCCCACAGGGG - Exonic
1062740038 9:138166952-138166974 GACAGTGATCCTCTCCTCACAGG - Intergenic
1186314967 X:8359336-8359358 TACAGTGTTCCTCCCCTCCTGGG + Intergenic
1192202488 X:69075533-69075555 GCCAGTGCTGGTCCCCTCAGAGG + Intergenic
1194539365 X:95152303-95152325 CACAGTGTTCCTCCCCTCCAGGG - Intergenic
1195666758 X:107438582-107438604 GACAAGGTTACTGCTCTCAGGGG - Intergenic
1196485206 X:116198314-116198336 AACACTTTTACTCTCCTCAGTGG + Intergenic
1201189024 Y:11430513-11430535 GACAGTCTTGCTCACCTCCGGGG - Intergenic