ID: 954646506

View in Genome Browser
Species Human (GRCh38)
Location 3:52134965-52134987
Sequence CTGGGAGGTGGCGATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954646506 Original CRISPR CTGGGAGGTGGCGATGTGGT GGG (reversed) Intronic
900411830 1:2516052-2516074 CAGGGAGGTGGTGATGGGGGAGG - Intronic
900420175 1:2552829-2552851 CTGGAAGGTGGGGATGTTGAAGG + Intergenic
900424256 1:2568829-2568851 CTGGAAGGTGGGGATGTTGAAGG - Intergenic
900905255 1:5552591-5552613 CTGGGAGGAGGGGATGTTGTGGG + Intergenic
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
901627263 1:10631321-10631343 GAGGGAGGAGGCCATGTGGTTGG + Intergenic
901665727 1:10825072-10825094 CCGGGAGGTGGGAATGTGCTAGG + Intergenic
901844014 1:11970988-11971010 CTGAGGGGTGGGGATGGGGTTGG + Intronic
901866974 1:12112767-12112789 CTGGGAGGTTGTGATGGGCTGGG - Intronic
902505197 1:16935367-16935389 CTGGGAGGTGGCTCTGTGTCAGG + Intronic
903283631 1:22263975-22263997 CTGGGTGGTGGTGGTGGGGTGGG + Intergenic
904260093 1:29283272-29283294 CTGGGAGGTGGGGCTGTGGGAGG - Intronic
905515150 1:38557302-38557324 CTGAGAGGTGGGGATGTCATTGG - Intergenic
906723873 1:48029362-48029384 CTGGGAGGTAGTGATGTGAATGG - Intergenic
907324358 1:53627201-53627223 CTGGGAGGGGGAGGTGTGGGCGG + Intronic
907333225 1:53684782-53684804 CTGAGAGGTGGTCATGGGGTAGG - Intronic
907742298 1:57178884-57178906 CCAGGAGGTGGCGATGGGGGTGG - Intronic
907799541 1:57751141-57751163 CTGGGAGGTGGCCTAGTGGGAGG + Intronic
907850057 1:58247787-58247809 GTGGGAGGTGGGGGTGGGGTGGG - Intronic
910520451 1:88115767-88115789 CTGGGAGGTGGTGGGGTAGTGGG - Intergenic
910867146 1:91799036-91799058 CTGGGAGGTTGTGGTGTAGTGGG - Intronic
911039439 1:93580065-93580087 CTGGGAGGTGGGGCTGAGGGTGG - Intronic
912373392 1:109191023-109191045 CTGGGAGATGGCCATGTTGCTGG + Intronic
913480184 1:119280580-119280602 CTGGGAGTTGGGGATGTGAGTGG - Intergenic
914984058 1:152441450-152441472 TTGGGAGGTGGGGGTGGGGTGGG + Intergenic
915586004 1:156844357-156844379 CTGGGAGGTGAGGATGGGGAGGG + Intronic
915912542 1:159923776-159923798 GTGGGAGGAGGGGATGAGGTGGG + Intronic
916660699 1:166920601-166920623 CGGGGAGGTGGCGAGGCGGGAGG - Intronic
920002466 1:202809059-202809081 TTGGGAGGTGGAGATGTTGCAGG + Exonic
920434017 1:205936634-205936656 CTGGGAGGTAGAGGGGTGGTGGG - Intronic
922804353 1:228377908-228377930 CTGGGAGGGGCACATGTGGTTGG - Intronic
923449240 1:234101036-234101058 ATGGGAGGAGGCCATCTGGTAGG - Intronic
924580959 1:245323951-245323973 GTGGGAGGTGGAGGTGGGGTGGG + Intronic
924588519 1:245380896-245380918 CTGGGAGGTGGGGAGGTTGGTGG + Intronic
924698561 1:246426411-246426433 CTGGGAGGTCGAGATGGGGTAGG - Intronic
924740635 1:246792710-246792732 GTGGGATGTGGGGATGTGGGGGG - Intergenic
1063629065 10:7717407-7717429 CTGGGAGCTGGAGATCGGGTAGG + Intronic
1063663284 10:8048201-8048223 CTGGGGGTTGGGGCTGTGGTTGG + Intergenic
1064507142 10:16044540-16044562 ATTGGAGATGGCGATGTTGTTGG - Intergenic
1065971566 10:30810036-30810058 CTGGGAATTGGAGAAGTGGTGGG + Intergenic
1066221571 10:33339810-33339832 CTGGAAGGAGGAGATGTGGAGGG + Intergenic
1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG + Intergenic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1067745642 10:48933732-48933754 CTGAGAGTTGGCGATGGGGCTGG + Intronic
1068053653 10:51983324-51983346 GTGGGAGGTGGCCATGGGGAGGG + Intronic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1072813871 10:98485897-98485919 GTGGGATGTGGGGAAGTGGTGGG + Intronic
1073035723 10:100562973-100562995 CGGGGAGGTGGGGGTGTGGGTGG + Intergenic
1073142068 10:101254728-101254750 CTGGGAGGTGGCCAGGTGGGAGG - Intergenic
1073177566 10:101565710-101565732 CTGGGGGGTGGTGATGAGGTGGG - Intergenic
1073287209 10:102396188-102396210 ATGGGAGGTGGGGCTGTGGGGGG + Intronic
1073457569 10:103646950-103646972 CTGGGAGATGGCAGTGTGGCAGG - Intronic
1074659453 10:115636308-115636330 CTGTGAGATAGGGATGTGGTGGG - Intronic
1075182581 10:120225198-120225220 CTGGAAGGTGGCAATGGAGTGGG + Intergenic
1075561226 10:123470021-123470043 CAGGGAAGTGGCCATGGGGTGGG + Intergenic
1075604855 10:123797275-123797297 CTGGGTAGTGGCGGTGGGGTAGG - Intronic
1076116577 10:127905801-127905823 CTGGGAGGTGGACTTGAGGTGGG + Intergenic
1078218601 11:9333095-9333117 TTGGGAGGAGGCAATGTGATAGG - Intergenic
1082833165 11:57634376-57634398 CTGAGAGGTGGGGAAATGGTGGG - Intergenic
1083332469 11:61905349-61905371 CTGGGAGGGGGCAAAGTGGGAGG + Intronic
1083841883 11:65309257-65309279 CGGGGAGGTGGCTGTGGGGTTGG + Intergenic
1083989666 11:66239180-66239202 CTGGAGGGTGGTGATGTGGAGGG - Exonic
1084755768 11:71237753-71237775 CTGGGAAGGGGAGATGGGGTAGG - Intronic
1085040586 11:73324211-73324233 CTGGGATGTGGAGATGTGGGTGG + Intronic
1085199205 11:74691545-74691567 CTGGGAGGTGGGGCTGTGATTGG - Intergenic
1085263902 11:75224987-75225009 CTGGGTGGTGGTGAGGAGGTGGG - Intergenic
1088469412 11:110177257-110177279 GTGGGAAGTGGTGAGGTGGTGGG + Intronic
1088909870 11:114182696-114182718 ATGGGAGGGGGCGAAGTGGGAGG - Intronic
1089492812 11:118894365-118894387 CAGGAAGATGACGATGTGGTAGG - Exonic
1089540747 11:119187858-119187880 CTGGGAGGAGGGGCTGTGGGGGG + Intronic
1089721279 11:120425207-120425229 CTAGCAGGTGGTGATGGGGTGGG + Intronic
1091301337 11:134510014-134510036 CTGGGAGCTGAGGATGTGGAGGG - Intergenic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1092711269 12:11340139-11340161 CTGGGAGGTGGCAGTGAGGCTGG - Intergenic
1093453669 12:19342927-19342949 CTGGGAGGGGGAGATGTGGCAGG - Intronic
1094350638 12:29521110-29521132 TTCAGAGGTGGCAATGTGGTTGG + Intronic
1094476500 12:30844635-30844657 TGGGGAGGTGGTGGTGTGGTGGG - Intergenic
1096107237 12:49003516-49003538 CTGGGAGGTAGGGAAGTGGTGGG - Intronic
1098958662 12:76715014-76715036 CTGGGAGGTGCAGGTGTGGATGG + Intergenic
1101997465 12:109535288-109535310 CTGGGAAGAGGCGCTGTGGACGG - Exonic
1102247953 12:111367140-111367162 CTTGGAGGTGGGGATGTGTCTGG - Intronic
1103717855 12:122956192-122956214 CTGGGAGGTGTCTATGTGCCAGG + Intronic
1104149721 12:126070916-126070938 CTGGGAGCTGGTGAGGAGGTGGG + Intergenic
1105313825 13:19237893-19237915 CTGGGAAGTGGGGAGGGGGTTGG + Intergenic
1106292779 13:28380675-28380697 CTGGGTGGTGGAGGGGTGGTGGG + Intronic
1107950661 13:45458698-45458720 CTGGGTGGTGGGGATGAGGGTGG - Intergenic
1108323367 13:49307139-49307161 TTGGGAGGTGGAGATGGGGGTGG - Intergenic
1113916221 13:113875588-113875610 ATGGGAGGTGGCCATGTGGCTGG + Intergenic
1115339800 14:32281036-32281058 CTGGGAGGTGGAGGTGCAGTGGG + Intergenic
1116049827 14:39789269-39789291 CTGGGAAATGGCCATTTGGTGGG + Intergenic
1117423632 14:55573265-55573287 CTGGGGGGTTGGGGTGTGGTTGG - Intronic
1117834443 14:59787685-59787707 CTGGGAGGTGGGGAAGAGGCTGG + Intronic
1118749645 14:68796199-68796221 CTTGGAGGTGGTGGTGGGGTGGG + Intronic
1119253009 14:73173494-73173516 GTTGGAGGTGGTAATGTGGTTGG + Intronic
1119842611 14:77804603-77804625 CTGGGAGGTGGTGTTGGGGTGGG + Intronic
1120070700 14:80099181-80099203 CTGGGGTGTGCAGATGTGGTCGG - Intergenic
1120530244 14:85622712-85622734 GTGGGAAGTTTCGATGTGGTAGG - Exonic
1121433393 14:93903146-93903168 CCTGGAGGTGGGGATGTGGCAGG - Intergenic
1122262599 14:100531775-100531797 CTGGGTGGGGGTGATGGGGTGGG - Intergenic
1202834290 14_GL000009v2_random:66165-66187 CTAGGAGGTGGAGCTGTGTTGGG + Intergenic
1125605541 15:40937931-40937953 CTGGGAGAAGGCGATGGGGCAGG - Intronic
1125893370 15:43282140-43282162 GTGGGAGGTGGAGATGGGATAGG + Intronic
1126397892 15:48238601-48238623 CTGGGAGGTGACAATATGTTGGG + Intronic
1127278683 15:57470091-57470113 CTGAGAGCTGGAGAAGTGGTGGG + Intronic
1127415682 15:58755096-58755118 CTGGCAGGTGGGGAAGCGGTGGG - Intergenic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128766716 15:70255591-70255613 GTTGGAGGTGGGGATCTGGTGGG - Intergenic
1129622277 15:77158964-77158986 GTGGGAGGTGGTGATGTTGGTGG + Intronic
1129632638 15:77278445-77278467 CATGGTGCTGGCGATGTGGTAGG - Intronic
1130274850 15:82471035-82471057 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1130467200 15:84198404-84198426 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1130486411 15:84400779-84400801 CTGGGAGGTGCTGATGTGAGAGG + Intergenic
1130497063 15:84475132-84475154 CTGGGAGGTGCTGATGTGAGAGG + Intergenic
1130589494 15:85203002-85203024 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1131159928 15:90099066-90099088 CTGGGTGGTGGCGCTGGGGATGG - Intronic
1132505782 16:307977-307999 CTGTCAGGTGGGGCTGTGGTTGG - Intronic
1132814229 16:1818270-1818292 CTGGGTGGTGCCGGTGTGGGAGG - Intronic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1133342250 16:5044358-5044380 CTTGGTGGTGGCGGTGTGGATGG + Exonic
1133461391 16:5989582-5989604 ATGGGTGCTGGCGATGTGGGTGG + Intergenic
1134529933 16:14975228-14975250 CCGGGAGGGGGCGATGGGGACGG + Intronic
1135236232 16:20759144-20759166 ATGGGAAGTGGCGTGGTGGTGGG - Intronic
1135675534 16:24411886-24411908 ATGGGAGGTGGGGGTGAGGTGGG - Intergenic
1136605168 16:31329091-31329113 CTGGGGGGTGGAGATGGGGTGGG - Intronic
1136731459 16:32417524-32417546 CTGCGAGGTGGCAGTCTGGTTGG - Intergenic
1137574489 16:49589989-49590011 CTGGGAGGTGGAGATGGGATGGG + Intronic
1138303173 16:55949495-55949517 CTGGCATGAGGGGATGTGGTGGG - Intronic
1139310347 16:66023327-66023349 CTGGGAGGTGGTGATGGTGGTGG - Intergenic
1139667633 16:68468872-68468894 CAGGGAGGTGGAGAGGTGGAGGG + Intergenic
1139866413 16:70065726-70065748 CCGGGAGGGGGCGATGGGGACGG - Intergenic
1140820835 16:78661639-78661661 CTGAGAGGTGGGGAGGGGGTGGG + Intronic
1140856115 16:78979249-78979271 CTGGGAGGTGGGAATGGGGATGG - Intronic
1141533424 16:84662155-84662177 CTGGGAGGTGACGGTGAGGATGG - Exonic
1142351478 16:89582769-89582791 CTGGGAGGTCACAATGAGGTAGG - Intronic
1202994933 16_KI270728v1_random:99746-99768 CTGCGAGGTGGCAGTCTGGTTGG + Intergenic
1203021620 16_KI270728v1_random:412088-412110 CTGCGAGGTGGCAGTCTGGTTGG + Intergenic
1143481065 17:7227620-7227642 CTGGGAGGGTGGGATGAGGTGGG + Intronic
1144833311 17:18143661-18143683 CTGGCAGGTGGGGATGTGGCAGG + Intronic
1146007202 17:29168167-29168189 CTGCGAGGTGGGGGTGGGGTAGG + Intronic
1146921565 17:36716181-36716203 CTGGGTGGCTGAGATGTGGTGGG + Intergenic
1146935927 17:36812777-36812799 CTGGAAGGCAGGGATGTGGTAGG + Intergenic
1147568177 17:41550424-41550446 CTGGGAGGTGGGGATGAAGGAGG + Intergenic
1147898902 17:43770692-43770714 CTGGGAGCTGGGGATGGGGGTGG + Intronic
1147930449 17:43977360-43977382 CTGGGAGGTGGCGGAAAGGTGGG - Intronic
1148280753 17:46345358-46345380 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1148302981 17:46563293-46563315 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1148492016 17:48029273-48029295 CTGGAAGGTGGAGATGTTGCAGG - Intronic
1148672077 17:49418857-49418879 CTCGGAGAGGGGGATGTGGTGGG + Intronic
1148790241 17:50168669-50168691 CTGGGAGGTGGAGATGTGCGTGG - Intronic
1148867285 17:50635111-50635133 CCGGGAGGGGGCGATGGGCTCGG + Intronic
1149429335 17:56584834-56584856 ATGGGAGGTGGGGATGAGGATGG + Intergenic
1151208760 17:72528137-72528159 CAGGGAGGTGGACATGGGGTGGG - Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151678719 17:75613219-75613241 CTGGGAGGTGGGGACCTGGCAGG + Intergenic
1151732173 17:75917974-75917996 CTGGGAGGTGGTGAGGTGCGAGG + Exonic
1152634446 17:81424896-81424918 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634475 17:81425052-81425074 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634515 17:81425217-81425239 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634566 17:81425426-81425448 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634597 17:81425557-81425579 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634619 17:81425643-81425665 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634628 17:81425683-81425705 GTGGTTGGTGGCGATGTGGTTGG + Intronic
1152634637 17:81425726-81425748 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634642 17:81425755-81425777 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634668 17:81425874-81425896 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634679 17:81425945-81425967 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634708 17:81426068-81426090 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634734 17:81426183-81426205 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152659876 17:81537248-81537270 CTGGGAGGTGGTCTTGTGGATGG + Intergenic
1152666711 17:81574618-81574640 CTGGCGGGTGGCGAGGTGTTGGG - Intronic
1154107383 18:11534272-11534294 CTGGGCAGTGGCCAGGTGGTAGG + Intergenic
1156840087 18:41600884-41600906 CTGTGAGGTTGCAATGAGGTTGG + Intergenic
1157633360 18:49123569-49123591 CTGGAAGGAGGAGAAGTGGTTGG - Intronic
1158509691 18:58079609-58079631 CGGGGAGGTGGCCAAGTGATCGG - Intronic
1159055004 18:63454645-63454667 CTGGCAGCCGGCGATGTGGAAGG - Intergenic
1160883274 19:1332189-1332211 GGGGGATGTGGCGGTGTGGTGGG + Intergenic
1161043809 19:2123830-2123852 CTGGATGCTGGCGCTGTGGTTGG + Exonic
1161091295 19:2361201-2361223 GTGGGAGGTGGGGCTGGGGTGGG + Intergenic
1161091309 19:2361232-2361254 GTGGGAGGTGGGGCTGGGGTAGG + Intergenic
1161466110 19:4431486-4431508 TTGGGAAGTGGGGATTTGGTGGG + Intronic
1162337327 19:10070051-10070073 GTGGGAGGAGGTGATGTGGAAGG + Intergenic
1163123752 19:15233142-15233164 CGGGGAGGGGGCGGTGGGGTGGG + Intronic
1163295319 19:16408008-16408030 GTGGGAGCTGGGGATGTGGGTGG + Intronic
1165154911 19:33781056-33781078 CTGGGAGGATGAGATGGGGTCGG + Intergenic
1165354669 19:35296090-35296112 CTGGGAGGTGCTGATTTGGCTGG + Intronic
1165741531 19:38207765-38207787 CTCGGAGGTGCCGGTGTGGATGG + Exonic
1166653960 19:44596589-44596611 CTGGGTGCTGGAGATGTGGCAGG + Intergenic
1166698431 19:44867652-44867674 CTGGGAGGTGGGCATGAGATGGG + Intronic
1166874812 19:45890861-45890883 CTGGGAGGTGGCGGTGGGGGTGG + Exonic
1167499588 19:49837610-49837632 CTGGGTGGTGGCGGTGTCGGGGG + Intronic
1202635297 1_KI270706v1_random:39414-39436 CTAGAAGCTGGCCATGTGGTTGG + Intergenic
1202638393 1_KI270706v1_random:61527-61549 CTAGGAGGTGGAGCTGTGTTGGG - Intergenic
926120097 2:10237136-10237158 CAGGGAGGAGGTGATGGGGTGGG + Intergenic
926394064 2:12423536-12423558 CTGGAAGGTGGGGATGGAGTGGG - Intergenic
926710329 2:15874512-15874534 GTGGGAGGTGGCTATGTGGAAGG - Intergenic
926833489 2:16990871-16990893 CTGGCGGGTGGGGATTTGGTGGG - Intergenic
927002761 2:18816055-18816077 CAGGGAGGTGGAGATGGGGTAGG - Intergenic
927089621 2:19700643-19700665 CTGGGTGGTGGCCTGGTGGTGGG - Intergenic
928688334 2:33773306-33773328 GTGGGAGGTGGGGGTGGGGTAGG - Intergenic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
929423420 2:41818821-41818843 CTGGGAGGTGGAGGTGTGAGTGG + Intergenic
929561000 2:42956399-42956421 GTGGGAGGTGGGGAAGTGGAAGG - Intergenic
931464283 2:62473280-62473302 CTGGGTTTTGGCGGTGTGGTTGG - Intergenic
933162569 2:79042130-79042152 GTGGGAGGTGGGGATGGGGGAGG - Intergenic
933699405 2:85243881-85243903 CTGGGGGTGGGAGATGTGGTGGG + Intronic
935195781 2:100815030-100815052 ATTGGATGTGGCGATGTGCTGGG + Intergenic
936680777 2:114768700-114768722 CTGACAGGTGGCCCTGTGGTAGG - Intronic
936916854 2:117648867-117648889 CTGGGAGCTGGAGATGTAGCTGG + Intergenic
937085180 2:119166928-119166950 CTGGGAAGTTGCCATGTGCTGGG + Intergenic
937117001 2:119414298-119414320 CTGGGATGTGCTGATGTGGCAGG - Intergenic
937826544 2:126373314-126373336 CTGGGAGATGGGTATGTGGCAGG - Intergenic
938034728 2:128027164-128027186 CTCGGCGGCGGCGATGTGCTCGG + Exonic
939032801 2:137096437-137096459 CTGGGAAGTGGGGATGTGAGTGG - Intronic
939465364 2:142547595-142547617 CTGGCAGGTGGGGATGAGGGAGG - Intergenic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
940611026 2:155992215-155992237 AAGGGAGGTGGAGGTGTGGTGGG - Intergenic
941324127 2:164091847-164091869 CTGGCAGGTGGGGAGGGGGTGGG - Intergenic
944171339 2:196782129-196782151 TTGGGAGGTGCCTATGTGGGTGG + Intronic
944859125 2:203798118-203798140 CTGGGAGGCGGGGTTATGGTGGG - Intergenic
945058470 2:205888253-205888275 CTGGCAGGTGCCAAGGTGGTAGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946833141 2:223745298-223745320 GGGGGATGTGGGGATGTGGTGGG + Intergenic
948701566 2:239763934-239763956 CCAGGAGGTGGCGGTGTGCTTGG - Intronic
948799826 2:240427497-240427519 GTGGGAGGTGGCCAGGTGGCTGG + Intergenic
1169163485 20:3403172-3403194 CTTGGATGTGGCAATGTGGAAGG - Intronic
1169659430 20:7961967-7961989 CTGGGCAGTGGGCATGTGGTGGG - Intergenic
1170387884 20:15840288-15840310 ATGGGAAGTGAAGATGTGGTGGG - Intronic
1172850062 20:37955404-37955426 CTGGAAGGTGGTGGTGGGGTGGG - Intergenic
1174358896 20:50015671-50015693 CTGGGGAGTGGCGAAGAGGTGGG + Intergenic
1175988304 20:62775299-62775321 TTGGGAGGTGAGGATGGGGTTGG - Intergenic
1176042205 20:63071863-63071885 CTGGGAAGTGGCCTTGTGGGCGG - Intergenic
1176104065 20:63377436-63377458 CGGGGAGGTGGCGGTGCGGTGGG - Intronic
1176410679 21:6447971-6447993 CTGGCCTGTGGGGATGTGGTGGG + Intergenic
1176524513 21:7855867-7855889 CTGGCAGCTGGCCATGTGGAGGG - Intergenic
1177905499 21:26967292-26967314 CTGGGACCCGGCGAGGTGGTAGG + Intergenic
1178499316 21:33112634-33112656 GTGGGAGGCTGCGATGTGGTGGG + Intergenic
1178658533 21:34485880-34485902 CTGGCAGCTGGCCATGTGGAGGG - Intergenic
1178684979 21:34703504-34703526 GTGGGAGGTGGCTGTGTGGGTGG + Intronic
1179686173 21:43056293-43056315 CTGGCCTGTGGGGATGTGGTGGG + Intronic
1180363572 22:11920361-11920383 CTAGGAGGTGGAGCTGTGTTGGG + Intergenic
1182361553 22:29749444-29749466 CCGGGAGGTGGCCATGTGCCTGG - Intronic
1182446563 22:30393059-30393081 CTGGGAGGAGGGGAGGAGGTTGG + Intronic
1183314859 22:37131354-37131376 TTGGGGGGTGGGGATGAGGTAGG - Intronic
1183510064 22:38229544-38229566 CTGGGTGGGGGCAGTGTGGTGGG - Intronic
1183540547 22:38427027-38427049 CTGGGAGGGGGCGGTGGGGCGGG + Exonic
1183585303 22:38749943-38749965 CTGGCAGGTGGGGGTGGGGTAGG - Intronic
1183666784 22:39250664-39250686 CTGGGAGGTGGCAAAGCTGTGGG - Intergenic
1183670105 22:39267677-39267699 CTGGGTGGTGGGGCTGTGGGTGG - Intergenic
1184913631 22:47552172-47552194 CTGGGAAGTGGGGATGTTCTGGG - Intergenic
1185070864 22:48654915-48654937 CTGGGAGGAGGGGCCGTGGTGGG + Intronic
950424906 3:12919898-12919920 CAGGGAGGTGGGCATGTGCTGGG - Intronic
952887961 3:38023065-38023087 CAGTGAGGTGGCCATGTGGTGGG + Intronic
954269364 3:49495587-49495609 GTAGGAGGTGGAGAGGTGGTGGG - Intronic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
954800870 3:53186312-53186334 CTGGAAGGTGCAGATGAGGTGGG - Exonic
955463902 3:59216115-59216137 GTGGGAGATGAGGATGTGGTGGG + Intergenic
955840583 3:63108647-63108669 CTGGGTGGTGGAAATGTGGCTGG + Intergenic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
957461182 3:80522567-80522589 CTGAGTGGTGGTGATGGGGTTGG + Intergenic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
963144215 3:141975755-141975777 CTGGGAGGAGGCAATGTGATAGG + Intronic
963902139 3:150743068-150743090 TTGGGTGGTGGGGATGGGGTTGG + Intronic
964406799 3:156356990-156357012 CTGGCATGTTGTGATGTGGTGGG + Intronic
964432403 3:156621145-156621167 CTGGGAGATGGGTATGTGGCAGG + Intergenic
966542244 3:181105340-181105362 GGGGGAGGTGGGGATGGGGTAGG - Intergenic
967049727 3:185771364-185771386 CTGGGAGGTGGAGTTGCAGTGGG + Intronic
968556070 4:1247154-1247176 CTGAGAGGTGGGCGTGTGGTTGG - Intronic
968557011 4:1250561-1250583 CCGGGAAGGGACGATGTGGTTGG + Intergenic
969694911 4:8729045-8729067 CTGGGAGGTGGCGTGGGGGAGGG + Intergenic
969740323 4:9020263-9020285 CTGGGAGGCGGAGGTTTGGTCGG + Intergenic
971662207 4:29433565-29433587 CTGTGGGGTGCCGAGGTGGTAGG - Intergenic
973368628 4:49227870-49227892 CTAGGAGGTGGAGCTGTGTTGGG - Intergenic
973392421 4:49567555-49567577 CTAGGAGGTGGAGCTGTGTTGGG + Intergenic
974438087 4:61882670-61882692 CAGTGAGGTGGCAATGTGGCTGG - Intronic
978141159 4:105318803-105318825 CTGGGGGTTGGAGAGGTGGTTGG - Intergenic
979059790 4:116043410-116043432 CTGGGAGGAGGCGATGATGCTGG + Intergenic
982564440 4:156971162-156971184 CTGAGCTGTGGCGAAGTGGTGGG + Exonic
982888130 4:160809705-160809727 CTGGGAGGTTGCAATTTGGTGGG + Intergenic
1202765727 4_GL000008v2_random:147385-147407 CTAGGAGGTGGAGCTGTGTTGGG - Intergenic
986445917 5:7821090-7821112 TTGGGAGGAGGGGAAGTGGTAGG + Intronic
987148746 5:15017738-15017760 CTGGGAGGTGGGGGTCTGGTGGG + Intergenic
988704500 5:33711231-33711253 TGGGGAGGTGGGGATGTGGCTGG - Intronic
997304743 5:132829174-132829196 CTGGGAGGGGGAGTTGGGGTGGG + Intronic
997305631 5:132833875-132833897 CTGATAGGTGGGGAGGTGGTGGG + Intergenic
999113782 5:149143514-149143536 CTAGGAGGTGGGGGTGGGGTGGG - Intronic
999222107 5:149988902-149988924 CTGTGAGGTGGGAATGAGGTTGG - Intronic
999244593 5:150147251-150147273 CTGGGGGGTGGGGATGGGGAGGG - Intronic
1000338458 5:160259417-160259439 CTGGGTGGTGGGGAAGGGGTGGG + Intronic
1000411389 5:160937560-160937582 CTGGGAGATGGGTATGTGGCAGG - Intergenic
1000773008 5:165380557-165380579 CTGGGAGGTGGTGAAGTGTTAGG - Intergenic
1001313957 5:170629739-170629761 CTGCGTGCTGGGGATGTGGTGGG - Intronic
1003098404 6:3159033-3159055 CTTGGAGCTGGCTTTGTGGTAGG + Intergenic
1005876465 6:30013714-30013736 CTGGCAGGTGCCGATGTTGATGG - Intergenic
1006163372 6:32050509-32050531 TTGGGAGGTGGGGGTGAGGTGGG - Intronic
1006163992 6:32053899-32053921 TTGGGAGGTGGGGGTGAGGTGGG - Intronic
1006164620 6:32057097-32057119 TTGGGAGGTGGGGGTGAGGTGGG - Intronic
1007629556 6:43265219-43265241 CTGGGAGGTGCCCAGGTGTTGGG + Intronic
1007758426 6:44116425-44116447 CAGGGAGGTGGGCATGGGGTTGG - Intronic
1008399027 6:51042417-51042439 CAGGGAAGTGGCCATGAGGTGGG + Intergenic
1009735897 6:67675357-67675379 CTGGGAGGGAACGGTGTGGTGGG + Intergenic
1013193718 6:107826645-107826667 CTGGGAGGAGGCAAGGAGGTTGG - Intergenic
1013644368 6:112121553-112121575 CTGGAAAGAGGCGATGGGGTTGG + Intronic
1015323360 6:131900740-131900762 ATGGGAGGTGGGGAGGTGTTAGG - Intergenic
1015751979 6:136569549-136569571 TTGGGAGGTGGGGAAGTGGTTGG - Intronic
1016472594 6:144390219-144390241 CTGGGACGTGGTGAGGTGGATGG - Intronic
1016989865 6:149921734-149921756 CTGGGTGGTGTGGATGTGATGGG - Intronic
1016993184 6:149943328-149943350 CTGGGTGGTGTGGATGTGATGGG + Intronic
1017005147 6:150024203-150024225 CTGGGTGGTGTGGATGTGATGGG - Intronic
1018213813 6:161507465-161507487 CTCGAAGGTGGCTATGGGGTGGG + Intronic
1018959930 6:168441078-168441100 CTGGGAGGTGGGGCTGGGGGAGG + Intergenic
1019164360 6:170088328-170088350 CTGGGAGCTGGGGCTGCGGTGGG - Intergenic
1019436733 7:1026048-1026070 CTGGGAGGTGGCAAGGGGGCAGG - Intronic
1019982105 7:4629379-4629401 CTGGGAGGTGGCCCTGTGAAGGG - Intergenic
1021312466 7:19111115-19111137 CTGGGAGGGGGTGATATTGTGGG - Intronic
1021656683 7:22880532-22880554 AGGGGATGTGGCGATGAGGTAGG - Intergenic
1022277192 7:28866892-28866914 CTTGGAGGCAGCGATGTGCTTGG - Intergenic
1023983350 7:45082004-45082026 CTCTGAGGTGGCGAGGTGGGGGG - Intronic
1024971806 7:55078302-55078324 CTGGGCTGTGGCGGTGGGGTGGG - Intronic
1026667615 7:72357287-72357309 CTGAGATCTGGCGATGTGGTTGG + Intronic
1029865570 7:103624376-103624398 GTGGTATGTGACGATGTGGTGGG - Intronic
1030057267 7:105594302-105594324 CTGGCAGATGGCGAGGTGGAAGG + Intronic
1030493816 7:110272129-110272151 CTGGGATGTGGCTATTTTGTTGG + Intergenic
1034056727 7:148043125-148043147 CTGGGAGGTGGCAATGTATCAGG - Intronic
1034474537 7:151275011-151275033 CCGGGAGGGGGCCATGTGGTGGG + Intronic
1035590391 8:808575-808597 CTGGAATGTGGGGATGTGTTTGG + Intergenic
1036591423 8:10172303-10172325 TTGGGAGGTGCTGATGGGGTTGG + Intronic
1036618613 8:10407403-10407425 CTTAGAGGTGGCGATGAGGGTGG + Intronic
1036787341 8:11697014-11697036 GAGGGAGGAGGCGATGAGGTCGG + Intronic
1037675095 8:21044220-21044242 GTGGGAGCTGGAGATGTGCTTGG + Intergenic
1037924265 8:22832263-22832285 CTGGGAGGTAGTGATGAGGGTGG + Intronic
1038060504 8:23907204-23907226 CTGGAAGGTGGCATTGTGGCAGG - Intergenic
1038443469 8:27587120-27587142 CTGGGAGGTGGAGATGGGCCTGG + Intergenic
1038660130 8:29490049-29490071 CTGGGATTTGGGGATGTGGCAGG + Intergenic
1041007276 8:53507928-53507950 GTGGGAGGTGGAGGTGGGGTGGG - Intergenic
1041090660 8:54298058-54298080 GTGGGAGGTGGGGAGGGGGTGGG + Intergenic
1043925131 8:86028159-86028181 CTGGGAGGTGAGGCTGTGGCTGG - Intronic
1047208623 8:122822742-122822764 CTGGCAGGTGGTGATGTCGCTGG - Intronic
1047509565 8:125505964-125505986 CTGGGAGGTGGGGGTGGGGGCGG + Intergenic
1048898333 8:139015081-139015103 CTGGGAGTGGGTGATGTGGAAGG - Intergenic
1049064488 8:140302165-140302187 CTGGGATGTGGGTCTGTGGTGGG - Intronic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1050472603 9:6008172-6008194 CTGGGAGGGGGCGAGGAGGAAGG + Intergenic
1052560309 9:30076869-30076891 TGGGGAGGTGGGGATGGGGTGGG - Intergenic
1053443763 9:38136116-38136138 GTGGGAGGAGGAGAGGTGGTGGG + Intergenic
1053478240 9:38397163-38397185 GTGGCAGGTGACGATGTTGTAGG - Exonic
1057173408 9:92977069-92977091 CTGGGAGGAGACGATGTGAGTGG + Intronic
1057198285 9:93127122-93127144 CTGGGAGGTTGGGAGGTGGCAGG - Intronic
1057949696 9:99359828-99359850 CTGGGAGCTGGCGATGGCTTTGG + Intergenic
1058894564 9:109388197-109388219 CTGGTGGGTGGTGATGTGGACGG + Intronic
1061206071 9:129164089-129164111 CAGGGAGGTGGGGAGGTGGCAGG + Intergenic
1061536888 9:131255840-131255862 GTGGGAGGTGGAGATGTTATGGG + Intergenic
1203546477 Un_KI270743v1:132275-132297 CTAGGAGGTGGAGCTGTGTTGGG - Intergenic
1185593109 X:1291640-1291662 GTGGGAGGTGGGGATGGGCTTGG - Intronic
1185616035 X:1422600-1422622 CTGGAAGGTGGAGAAGTTGTTGG + Intronic
1187066198 X:15840698-15840720 GTGGGGGGTGGTGATGTAGTTGG - Intronic
1187829884 X:23370314-23370336 CTGGGAGGTGCTGATGTTGGTGG - Intronic
1190329003 X:49224318-49224340 CTGGGAGTTAGGGATGAGGTGGG + Intronic
1190557643 X:51652559-51652581 CGGGGAGGGGGCGAGGTGGGTGG - Intergenic
1192082009 X:68057415-68057437 CTGGGAGGCGGAGTTGTGGAGGG + Intronic
1193490499 X:82143249-82143271 GGGGGAGGTGGCGATGGGGCTGG - Intergenic
1195556278 X:106228386-106228408 CGGGGTGGTGGCGATGGGGGTGG - Intergenic
1195565003 X:106330455-106330477 CTGAGAGGTGACCATGAGGTGGG - Intergenic
1198539506 X:137621724-137621746 CTGGGAGCTGAGGTTGTGGTGGG + Intergenic
1201675862 Y:16583415-16583437 CAGGGAGGTGGGGCTGTGTTAGG + Intergenic
1202345178 Y:23915112-23915134 CTGGGACGTGGTGATGGGGGTGG - Intergenic
1202525592 Y:25754977-25754999 CTGGGACGTGGTGATGGGGGTGG + Intergenic