ID: 954647488

View in Genome Browser
Species Human (GRCh38)
Location 3:52140482-52140504
Sequence TGGGCTTCCCAGCACCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954647479_954647488 22 Left 954647479 3:52140437-52140459 CCGGTGGCAGGAGGGTGCAGAAG 0: 1
1: 0
2: 1
3: 37
4: 331
Right 954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG 0: 1
1: 0
2: 0
3: 25
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954647488 Original CRISPR TGGGCTTCCCAGCACCATCA AGG Intronic
900230540 1:1554801-1554823 TGGGCAGCCCAGCACCATCCTGG + Intronic
901225491 1:7610797-7610819 TGGGCCTGGCTGCACCATCAGGG - Intronic
902228439 1:15011938-15011960 TGCTCCTCCCAGCACCTTCAGGG + Intronic
902634146 1:17724181-17724203 TGGATTTCCCAGCCCCACCATGG - Intergenic
903356586 1:22751851-22751873 TCCGCTTCCCAGGACCCTCATGG - Intronic
903811624 1:26037914-26037936 TGGGCTTCCCAGCCTCCCCAGGG - Intronic
904265785 1:29317954-29317976 TCCCCTTCCCAGCAGCATCAGGG + Intronic
904476676 1:30769469-30769491 GGGGCTTCCCAGGACCAACACGG + Intergenic
905428368 1:37902350-37902372 TGGGCTTTCCAGAAACATTAAGG - Intronic
905561345 1:38929609-38929631 TGAGCTCCCCAGCCACATCAAGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
908403631 1:63793285-63793307 TGAGCTTACCATCGCCATCATGG - Intronic
917213023 1:172649290-172649312 AGGGCTTCACAGTGCCATCAGGG + Intergenic
918381380 1:183959112-183959134 TTGGCTTCTCAGCAGCATCTTGG + Intronic
921065625 1:211620516-211620538 AGGGCTTCCCCACACCAGCAGGG + Intergenic
921948404 1:220904905-220904927 TGGGCTCACCAGCACTACCACGG - Intergenic
922753175 1:228080477-228080499 TGGGCTCCCCACCACCACCGGGG - Intergenic
922755975 1:228097186-228097208 TGGTCTTCCCTGCAGCATCCAGG - Exonic
1063675512 10:8137868-8137890 TGGCCTTGCCAGCAGCTTCATGG + Intergenic
1067748274 10:48952827-48952849 TGGGCTTCCCAACGCCATGAGGG + Intronic
1068950306 10:62770027-62770049 GGGGCTTCCCAGCAGCAGGAGGG - Intergenic
1069247886 10:66230722-66230744 AGGGCTTTCCATCACCATCAGGG - Intronic
1069655234 10:70083049-70083071 AGGGATTCCCAGCACCAACAGGG + Intronic
1070050923 10:72888927-72888949 TTGGCTTCCCTGCACCATACTGG + Intergenic
1070696001 10:78563550-78563572 TGGGCCTCCCACCTCCCTCACGG + Intergenic
1071336101 10:84601523-84601545 GGGGCTTCCTTGCACCCTCAAGG + Intergenic
1071901818 10:90128734-90128756 TTGACTTCCCAGCACACTCAAGG - Intergenic
1072727277 10:97822270-97822292 GGAGCTGCCCAGCACCACCAGGG - Intergenic
1072914342 10:99527750-99527772 TGGGCGTCCCTGCAGCTTCAGGG + Intergenic
1075390190 10:122086103-122086125 TGGGATTCCCAGGAGCACCATGG + Exonic
1075599347 10:123756023-123756045 TGGGTATCCCAAGACCATCATGG + Intronic
1075706249 10:124503408-124503430 TTGGCTTCCCTGCACCATACTGG - Intronic
1076043365 10:127270280-127270302 TGCACTTCCCACCCCCATCAAGG + Intronic
1076904216 10:133354376-133354398 TGGGCTTGCCTGCACCCCCAAGG + Intergenic
1076976715 11:177828-177850 TGGTCTTGCTAGCACCACCACGG + Intronic
1077406861 11:2386609-2386631 TGGTCTTCCCAGCCCTAGCATGG - Intronic
1077462891 11:2719640-2719662 TGGGCCTTCCACCACCAGCAAGG - Intronic
1077804742 11:5579388-5579410 TGGTCTCCACAGCACCATCAGGG - Intronic
1078600232 11:12724100-12724122 TGGGCTTGGCATCACCATGAAGG - Intronic
1083647284 11:64179570-64179592 TGGGCTTCCCCACACCATGGTGG + Intergenic
1084041904 11:66547298-66547320 TGGGCTCCCCACCCCCACCAGGG + Intronic
1085449435 11:76623062-76623084 ATGGCTTCCCAGCACCCTCAGGG + Intergenic
1085762572 11:79255005-79255027 TGGGCTTCCCATCATCTGCAAGG - Intronic
1092946445 12:13458455-13458477 GGCACCTCCCAGCACCATCAGGG - Intergenic
1093387420 12:18575233-18575255 TGAGGTTCCCAGCACCATATAGG - Intronic
1094041318 12:26123580-26123602 TGGGCTGCCCCGCTTCATCAGGG + Intronic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1098179271 12:67828713-67828735 TGGACTTCCCAGAACAATTAGGG - Intergenic
1102203243 12:111072756-111072778 TCCTCTTCCCAGCCCCATCAAGG + Intronic
1102235082 12:111289444-111289466 CTGGCTTCCCAGCATCCTCACGG - Intronic
1102521682 12:113481210-113481232 TGGTCTTCTCAGCACCCTCCAGG + Intergenic
1102951918 12:117036826-117036848 GGGGCATCTCAGCACCATCTGGG + Intergenic
1103213764 12:119186187-119186209 AGGGCTTCCCAACCCCCTCAGGG - Intronic
1103241026 12:119413600-119413622 TGGGCCTCTCAGCATCCTCATGG + Intronic
1103427132 12:120845560-120845582 TGGTCTTCCCTGCAGCATCCAGG + Intronic
1103814753 12:123645480-123645502 CGAATTTCCCAGCACCATCACGG - Exonic
1103927744 12:124433138-124433160 TGGGCCACCCAGCACCAGCCTGG - Intronic
1104533269 12:129593253-129593275 TTTTCTTCCTAGCACCATCATGG + Intronic
1106552652 13:30785342-30785364 TGGGCATCACAGCACCAGCCAGG + Intergenic
1108709842 13:53022207-53022229 TGGGCTTCGCAGCATCATGGTGG - Intergenic
1112567630 13:100564863-100564885 TGGGCTTCCCTCCCCCATAAAGG - Intronic
1121563460 14:94891830-94891852 TGGGGTTCCCAAGACCATCGGGG - Intergenic
1122310103 14:100788954-100788976 CTGGTCTCCCAGCACCATCACGG - Intergenic
1122341323 14:101030368-101030390 TGGGCTTCAGTGCCCCATCAGGG + Intergenic
1122880262 14:104687708-104687730 TGGGCCTCCCTCCCCCATCAGGG + Intergenic
1122883473 14:104700321-104700343 TCGGCTTCCCACCACCTCCAAGG - Intronic
1122978949 14:105182452-105182474 TGGGCTTCCCTGCAGCATGGTGG + Intergenic
1122983654 14:105202559-105202581 GGGGCATCCCAGGACCATCTGGG - Intergenic
1123939476 15:25209848-25209870 TGGGCTCACCAGCTCCATGAAGG - Intergenic
1125475722 15:40046924-40046946 TGGGCTTCCCCGAACAATCAAGG - Intergenic
1128391908 15:67188004-67188026 TGGGCTCCTCAGCATCACCAGGG - Intronic
1129396009 15:75246945-75246967 TGGGCTTCTCAGTACCCTAAAGG + Intergenic
1129723512 15:77890349-77890371 TGGGCTACCCAGGCCCATCAGGG - Intergenic
1129921300 15:79321269-79321291 TGTCCTTCCCACCACCACCAAGG - Intronic
1129955377 15:79631447-79631469 TGGTCTTCCAAGTGCCATCAGGG - Intergenic
1130866035 15:87934041-87934063 TGGATTTCCCAGCACCAGAAGGG + Intronic
1131394800 15:92077717-92077739 TGGGCTTCCCAGAGCCAGCAGGG + Intronic
1131843035 15:96458431-96458453 CTGGCTTCCCATCACCAGCAGGG + Intergenic
1131874164 15:96787130-96787152 TGGTCTTGCCAGCAGCAACAAGG - Intergenic
1132652375 16:1027380-1027402 TGGGCCTCCCAGAACCTCCATGG - Intergenic
1139291998 16:65867655-65867677 TTGGCTTCCCAGGAGCCTCAGGG + Intergenic
1139587309 16:67912339-67912361 TTTGGTTCCCAGCATCATCATGG + Intronic
1139808460 16:69590775-69590797 TGGGATTCCCCGCCCCATCTGGG + Intronic
1139849741 16:69943769-69943791 TGCGCTTCCCAGCTGCTTCAGGG + Intergenic
1139878735 16:70166766-70166788 TGCGCTTCCCAGCTGCTTCAGGG + Intergenic
1140373781 16:74428726-74428748 TGCGCTTCCCAGCTGCTTCAGGG - Intergenic
1140881745 16:79204723-79204745 TGGCCTTCCCAGAACAAACATGG + Intronic
1142443700 16:90120346-90120368 TGGTCTTGCTAGCACCACCACGG - Intergenic
1142463728 17:114869-114891 TGGTCTTGCTAGCACCATCACGG + Intergenic
1144614498 17:16756961-16756983 TGTCCTCCCCATCACCATCAAGG - Intronic
1145134162 17:20387002-20387024 TGTCCTCCCCATCACCATCAAGG - Intergenic
1145887927 17:28395824-28395846 TGGGCCTCCCAGCACCTGCCTGG + Exonic
1146009911 17:29185641-29185663 TGGCCTTCCCATGACCATCTGGG - Intergenic
1146885675 17:36469267-36469289 TGGGCTCCACAGCAGCATCTAGG + Intergenic
1148076890 17:44942329-44942351 TTGGCTTCCCAGCCCCAGCCTGG - Intronic
1150360847 17:64532604-64532626 TGGACTTCCCAGGACCAGCATGG + Intronic
1150557584 17:66268269-66268291 GGGGCTTCACAGCAGGATCAGGG - Intergenic
1151321335 17:73354433-73354455 TGGCCTTCCCACCAACATGATGG - Intronic
1151943081 17:77304978-77305000 TGGGCTGCCCAGGACCAGGAGGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1156382796 18:36579119-36579141 GAGGCTTCCCAGCACAAGCAAGG - Intronic
1156482822 18:37446809-37446831 TGTGCTGCCCAGCAACACCATGG - Intronic
1156577884 18:38339733-38339755 TGAGCTGGCCAGCACCAGCAAGG + Intergenic
1156899580 18:42285399-42285421 TGGCTTTTCCAGCACCCTCATGG + Intergenic
1157287578 18:46387551-46387573 TGTGCTTCCCGGCACCACCTGGG + Intronic
1157815011 18:50723904-50723926 TGGGCTTCCCAGAAGTATCTGGG + Intronic
1158568747 18:58578660-58578682 TAAGTTTCCCAACACCATCAGGG - Intronic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1162412829 19:10517041-10517063 TGGGCTCCCCACCTCCAGCATGG - Intronic
1164702658 19:30296793-30296815 TGGTCTTCCAAGCAGCATCTAGG + Intronic
1165248827 19:34513864-34513886 AGGGCTTCCCTGCACCCCCATGG + Intergenic
1165259088 19:34597686-34597708 AGGCCTTCCCTGCACCCTCATGG + Intronic
1165837872 19:38770461-38770483 CGGGCTTCCCAGCCCCACCTGGG + Intergenic
1165841693 19:38792236-38792258 CGGGCTTCCCAGCCCCACCTGGG - Intergenic
1166084536 19:40466142-40466164 AGGGCCTCCCAGAACCAGCAAGG + Intergenic
1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG + Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
929404888 2:41630264-41630286 AGGACTTCTCAGCACCATCCAGG + Intergenic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
932086682 2:68768883-68768905 TGGGTCTCCCAGATCCATCAGGG + Intronic
932863014 2:75313913-75313935 TTGGCTTCCAAGCACCAGAAAGG - Intergenic
933677135 2:85066913-85066935 TGTGTTTCCCAGCACCGTGAGGG + Intergenic
934518035 2:95001145-95001167 AGGGCTTCCCAGCATCTCCAGGG - Intergenic
934682709 2:96296676-96296698 TGGTCTTCCCAGCACCCTACGGG + Exonic
934771872 2:96912487-96912509 TGGGCTTCCCAGGGCCCTCCTGG - Intronic
936198067 2:110386718-110386740 TGGGCTTGTCAACACCAGCAGGG + Intergenic
937207720 2:120247113-120247135 TGGGCTTCCCACAACCTGCACGG - Intronic
939433875 2:142147619-142147641 TGGTCTTCCCAGAAACATCGTGG - Intergenic
941093104 2:161201672-161201694 TGGGCTACAGAGCACCACCAGGG - Intronic
941172307 2:162154302-162154324 TGGGGCTCCCAGTACCATAAGGG + Intergenic
942534881 2:176952395-176952417 TTGTCTTCCCAGCACAATCAGGG - Intergenic
943972330 2:194426865-194426887 TGGGTTTCCCAGGACAGTCAGGG - Intergenic
944155400 2:196602137-196602159 TGGGCTTCCCAGTGCCTTTATGG + Intergenic
946277987 2:218644903-218644925 ATGGCTTCCCAGCACCACCCTGG - Exonic
947533288 2:230926037-230926059 AGGGCCTCCCAGCACCTCCAGGG - Intronic
947551665 2:231050904-231050926 TGGGCTCCCCAGCCCCAGCTGGG + Intergenic
947591651 2:231389233-231389255 TGTGCCTCCCATCACCTTCAGGG - Intergenic
947634038 2:231671207-231671229 TTGGCTTCCCTGCACCAACAGGG - Intergenic
948591918 2:239055894-239055916 TGGTCTTTCCAGCCCCAGCAAGG - Intronic
948795303 2:240399511-240399533 TGGCCTTCTCAGCCCCCTCAGGG - Intergenic
1168808441 20:686978-687000 TGGCCTTCCCAGCCCCGTCTTGG + Intergenic
1168851805 20:982015-982037 TGGGCTGCTCAGCACCCCCAGGG - Intronic
1172446069 20:34994043-34994065 TTGCCTTCCCAGCAGCCTCATGG - Intronic
1177410320 21:20721380-20721402 TGGGCTTCTCAGCCTCCTCATGG - Intergenic
1177842630 21:26251650-26251672 TGGGCTGTGCAGCACCATCCAGG - Intergenic
1178474149 21:32921803-32921825 TGGTCTTCCCTGGACCATCTTGG + Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1180055053 21:45353422-45353444 TGGGCGTCCCACAGCCATCATGG - Intergenic
1180068423 21:45424271-45424293 TGGGCCTGCCAACACCACCAGGG - Intronic
1180942009 22:19665804-19665826 TGGCATTCACAGGACCATCAGGG - Intergenic
1180981422 22:19879823-19879845 AGGGGTGCCCAGCACCAGCAGGG - Intronic
1180982581 22:19885764-19885786 TTGGCTTCCCAGGACCAGCCAGG - Intronic
1180982706 22:19886379-19886401 TTGGCTGTCCAGCACCAGCAGGG - Intronic
1182873319 22:33667720-33667742 TGCTCTTACCAGCACCATTAAGG + Intronic
1184306012 22:43602383-43602405 TGGTCTCAGCAGCACCATCAGGG + Intronic
1185106299 22:48871744-48871766 TGGCCTTCCCAGTAGCATCCAGG - Intergenic
1185182566 22:49371825-49371847 TGGGCATCCCAGCGCCCCCAAGG - Intergenic
949443863 3:4112866-4112888 TGGGCTAGCTAGCACCATGAGGG - Intronic
951697034 3:25455757-25455779 TGGGCTTCCCTGCTTCGTCAGGG - Intronic
952807022 3:37365402-37365424 TGGGGTTACAAGCACCACCACGG + Intronic
952931608 3:38365184-38365206 TGGGTTTCCCAACAGCAACACGG + Exonic
953536707 3:43782501-43782523 TGGGCTTCACAGAACCTCCATGG + Intergenic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
954913331 3:54127516-54127538 TGGGCTTCCCACGAGCAGCAAGG - Intronic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
967379029 3:188837119-188837141 TGGGCTTCCCAGCAGCACCTTGG + Intronic
967929011 3:194677008-194677030 TGTGCGTTCCAGCACCATCCAGG - Intergenic
968363994 3:198171395-198171417 TGGTCTTGCTAGCACCACCACGG - Intergenic
968761769 4:2446031-2446053 TGAGCTTCCCAGAACCAACGTGG + Intronic
969609873 4:8221010-8221032 AGGGATTCCCAGCACAAACAAGG + Intronic
969701515 4:8770313-8770335 TGGCCTTCCCACCACCAGGATGG + Intergenic
973621297 4:52728649-52728671 TGTGCTTCACAGCATCCTCAGGG - Intronic
974992840 4:69115332-69115354 TGAGCTTCCCACCCCCACCATGG - Intronic
975327536 4:73077029-73077051 TGGGTCCTCCAGCACCATCAGGG + Exonic
976299996 4:83508178-83508200 TGGCCTACCCGCCACCATCAGGG + Intronic
985698066 5:1353048-1353070 TGGGCTTCCGAGCACCACAGGGG + Intergenic
987088748 5:14492265-14492287 TGGTCTTCCTTGCACCCTCACGG - Intronic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
991088662 5:62672277-62672299 TGGGTTTCCCATAACAATCAAGG + Intergenic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
995189115 5:109302066-109302088 TGGGATTTCTAGCACCAGCATGG - Intergenic
995442490 5:112207196-112207218 TGGCCATCCCAGCACCATTTAGG - Intronic
995799605 5:115979511-115979533 TGGGCTTCTCAGCTACATGAGGG - Intronic
996639116 5:125730839-125730861 TGGGCTTCCCAGATTCCTCAGGG - Intergenic
996688582 5:126311995-126312017 TGGCCATCCCAGAACCATCTGGG + Intergenic
998585330 5:143421127-143421149 TGGGCTTTTCTCCACCATCACGG + Intronic
999085609 5:148886157-148886179 TGGGCTTCCTAGAAACATGATGG - Intergenic
999450772 5:151676182-151676204 TAGGGTTCCCAGCACCATGAGGG - Exonic
1000294872 5:159904503-159904525 TGTGCTTCCCAGAACCTTAATGG + Intergenic
1002060386 5:176622119-176622141 TGGGTGTCCCAGCTCCATCCAGG + Intronic
1002278162 5:178116225-178116247 TGGGCTTCCAAGCAACAGGAAGG + Intronic
1006639136 6:35480013-35480035 TGGCCTGCCCAGCACCCTCCTGG - Intronic
1007730021 6:43939970-43939992 TGAGCTTCCAAGGCCCATCAGGG - Intergenic
1011671302 6:89685936-89685958 TGTGCTGACCAGCAACATCAAGG + Exonic
1013775398 6:113673636-113673658 TGGCCTTCCCAGCTCCTCCAGGG - Intergenic
1014418771 6:121215352-121215374 TGGGACTCCCACCAGCATCATGG + Intronic
1015937672 6:138419273-138419295 TGGTCTTCACAGCCTCATCAGGG - Exonic
1018621422 6:165732827-165732849 AGGGCTTCTCAGCCCCATCCTGG + Intronic
1018959866 6:168440822-168440844 GGGGCTTCCAAGCACAACCACGG - Intergenic
1019151145 6:170006780-170006802 GAGGCTTCCCAGCACCAGGAGGG + Intergenic
1019251822 7:18269-18291 TGGTCTTGCTAGCACCACCACGG + Intergenic
1019756485 7:2774474-2774496 AGGGCCTCCCAGCGCCATCAGGG - Intronic
1021858387 7:24880587-24880609 TTGGCTTTCCTGTACCATCATGG + Intronic
1023999607 7:45181967-45181989 TGGGCTTCCCAGACCCTTCCTGG + Intronic
1024112442 7:46161098-46161120 TCGGCTTCGCAGCACGAGCAGGG - Intergenic
1025106245 7:56174381-56174403 TGGCCTTCCCAGCCCCTCCAAGG - Intergenic
1028251351 7:88543019-88543041 TAGGTTTCCCAGCTCCCTCAGGG + Intergenic
1029402031 7:100352682-100352704 TGGTCCCCCCAGCACCATCGGGG - Exonic
1037711955 8:21361880-21361902 TGGACTTTCCAGGACCAACAAGG + Intergenic
1039576682 8:38629277-38629299 AGGGCTTCCCACCTCCAACAGGG - Intergenic
1041715364 8:60927229-60927251 AGGGCTTCCCAGCAGCACTAAGG - Intergenic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1045493709 8:102690291-102690313 TAGACTTCCCAGCATCATGAAGG + Intergenic
1046318961 8:112545529-112545551 TGCTCTTCCCACCACCATCTAGG + Intronic
1047995519 8:130331305-130331327 TGGGCTTGGCAGTTCCATCATGG - Intronic
1049709148 8:144055929-144055951 TCTGCTCCCCAGCACCATCCTGG - Exonic
1050038421 9:1462202-1462224 TGGGCTTCCCAGAATCAGCAAGG + Intergenic
1050115711 9:2261172-2261194 TGGGCTACCCAGCAGCATTCTGG + Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1057195437 9:93113724-93113746 AGGGGTTCCCAGCACCTTCTGGG - Intergenic
1060794881 9:126506767-126506789 TGGGCTGCCTGGCACCCTCAGGG + Exonic
1060982319 9:127800510-127800532 TGGCCTTCCCAGGAGCATCCTGG - Intronic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061278422 9:129583152-129583174 TGGGCTTCCCAGGCACAGCAGGG + Intergenic
1061399906 9:130362714-130362736 TGGGTTTCCCTGCATCATGAGGG + Intronic
1061890518 9:133616841-133616863 TCAGCCTCCCAGCTCCATCAGGG - Intergenic
1062149117 9:135008360-135008382 TGGGATTCACAGCACCAGAAAGG + Intergenic
1062366917 9:136214590-136214612 GTGGCTTCCCAGCACCCTCATGG - Intronic
1062748690 9:138235340-138235362 TGGTCTTGCTAGCACCACCACGG - Intergenic
1186292256 X:8113079-8113101 TGGTCTTCCCAACACCATAGCGG - Intergenic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1190049721 X:47140679-47140701 TGGGCTTCCCTTCACCCTCTTGG - Intergenic
1190925263 X:54898005-54898027 TGTGCTACCCGGCACCATGATGG - Intergenic
1191897830 X:66012454-66012476 GGGGCTTCTCAGCTCCTTCATGG + Intergenic
1192142582 X:68658615-68658637 TGGTCTTCCCAGCAGCCTCTAGG + Intronic
1192806341 X:74512812-74512834 TGGCTTTTCCAGCACCATCCTGG - Intronic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1196436161 X:115676506-115676528 TGGACTTCCCAGAACCACCATGG + Intergenic
1197712785 X:129683884-129683906 TGGGCTTCCCATCTCCCTCTGGG - Intergenic
1199681116 X:150225314-150225336 TGGGCTTCACAACCTCATCAGGG - Intergenic
1199724591 X:150568419-150568441 TGGGCTTCCCAGCAGCCTCTCGG + Intergenic
1200055911 X:153460814-153460836 TGGCCGTGCCACCACCATCACGG + Intronic
1200727265 Y:6686619-6686641 AGGGCTCCCCATCACCCTCAGGG - Intergenic
1200728417 Y:6702394-6702416 AGGGCTCCCCATCACCCTCAGGG - Intergenic
1201667297 Y:16472997-16473019 TGTCCTTCCCACCTCCATCATGG - Intergenic